foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 05.11.2014 r.

numer ogłoszenia 9/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 13 op. CEQ Separation Gel LPA Beckman Coulter 608010

        Zadanie 2: 7 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

        Zadanie 3: 10 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

   Zadanie 4: 11 op. Sample Loading Solution Beckman Coulter 608082

   Zadanie 5: 1 op. Agaroza o wysokiej rozdzielczości DNA, 500 g

   Zadanie 6: 10 szt. Oligonukleotydów, skala syntezy: 0,2 µmol; metoda oczyszczania: odsalanie; zawieszone  w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

Msca43_R

GCTACCGTAGTTAGCTGTTAC

Msca64_R

ACGCGGACGATGTCACGTGC

Msca7_R

AAAGGCGATTAAACGTGGTG

Msca47_R

GAGTAACGGGCCGTTTGTACG

Msca78_R

GGCAAACACGGCACCATGG

Myrt4_R

CGGCGATGCAAGTACGTC

Msca50_R

AGGTAGCGGCTAGCGTGTT

MS86_R

AGTCGTGAGTACAACAT

Msca1_R

CCCGCATTCGCATAGAAATA

MP84_R

AAAGGACAAACGGGAGACGAAC

 

Zadanie 7: 10 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

 

Nazwa

Sekwencja 5'-3'

Msca43_F

[D2]- CGACCGCGCACTTAATCGCG

Msca64_F

[D3]- GTTATCGTCACTATTACTGTCGC

Msca7_F

[D2]- GCTTTAATTCCGGGACACTC

Msca47_F

[D4]- GAACTGGATGCAAAGAGGCGC

Msca78_F

[D3]- CGGGTTAACGTGTTACTGGAG

Myrt4_F

[D3]- CGTGCATGCGAGCATTCCGT

Msca50_F

[D2]- AGCAACGCCACGCGTTACC

MS86_F

[D4]- GATAGCAGATAAAACGA

Msca1_F

[D3]- ACCAGGAAATGAGCCAACAG

MP84_F

[D2]- GCAGTTTAGGCGAGGCTCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

                               

Oryginał do pobrania: TUTAJ

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi