Unia Europejska

foto Piotr Ślipiński

 Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 15.12.2015 r.

numer ogłoszenia 37/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

   Przedmiotem zamówienia jest dostawa 33 szt. oligonukleotydów niemodyfikowanych – skala syntezy: 0,02-0,05 µmol; metoda oczyszczania: odsalanie; liofilizowane

Nazwa

Sekwencja 5'-3'

nFABP1fv

AAATCCGTGACCGAACTCAACG

nFABP1rv

GAGGTCTCCCTTCGTCATTGTATG

nHMGA1fv

GCACACAAGGCACTGTGAAGAG

nHMGA1rv

TTCTGGGCAGAGTAATTGTATCGC

nPPARGfv

TGGCAACTTTGCAGCTTGTGC

nPPARGrv

CAACGTTGTAAGGCCACGAACC

nTFRCfv

ACACTTATCCCATTCGGACATGC

nTFRCrv

GTGTGGTTGAATGAAGGGAAGCC

nPPARGC1Afv

TCAGACAAATCACCTGCAAGCC

nPPARGC1Afv

TGGAGACTCAGGTGTCAATGGAAG

TcyF1

TGCATTTCCAGCAGAGC

TcyF2

CTTGCAGTGTCCCTCTAAT

TcyR1

CTTCACTTTCATTTCGCCTTA

TcyR2

GCGGTTCAGGCAAAACT

TprF1

GTCCGACGTACATTCTTCT

TprF2

AGTGGGTGGTTGGCC

TprR1

GCCACCTCGCAACAC

TprR2

CACCGCTCGAACAAGT

TsiF

GCGGGCGGATTGTG

TsiR1

CTCAAAGCTGTACAGACGATT

TsiR2

TGTTGCGGTCCCACA

TspF

GTGCTGACATTGTTCCTGT

TspBR1

AAACCTGCACAATCAAAGGA

TspBR2

CGATCCGGTTGAACCGA

TspAF

GCATAAGGCTGGTCGGG

TspAR

CTCATACCAGCACAGTCAG

TviF

ATCGCAAGACAGTGGGTA

TviR1

ACCTTCAGTGCCACTCATT

TviR2

CCTTCAGTGCCACTCATTAA

TRNAH

TGAATTTTTTATTGTGATTAA

MRH106

AATTTCTAAAGACTTTTCTTAGT

MORF

ATCGGGGTTTAATAATGGG

MTHIS

AAATTCAATTGAAATTAATAGC


 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

 

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 10.12.2015 r.

numer ogłoszenia 40/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest wykonanie usługi wraz z dostawą odczynników w podziale na zadania:

Zadanie 1: Zestaw do zautomatyzowanej izolacji genomowego DNA z kału.

Zadanie 2: Protokół do zautomatyzowanej izolacji genomowego DNA z kału, przy pomocy stacji pipetującej Microlab STAR z programem sterującym Venus two.

 

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 10.12.2015 r.

numer ogłoszenia 41/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników NucleoSpin® Tissue (250 izolacji) nr kat.: 740 952.250, 1 op.

 

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 07.12.2015 r.

numer ogłoszenia 36/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników chemicznych w podziale na zadania:

Zadanie nr 1: Gliceryna bezwodna cz. 1l

Zadanie nr 2: Octan etylu cz. 2l

Zadanie nr 3: Wodorotlenek potasu cz. 1 kg

Zadanie nr 4: Kwas octowy cz. 80% 1l

Zadanie nr 5: Nadtlenek wodoru cz. 30% 5l

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi