foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 30.06.2015 r.

numer ogłoszenia 10/2015

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: proteinase K, 20mg/ml, 2ml

Zadanie 2: EDTA 0,5M, pH=8.0, 1L

Zadanie 3: TE buffer 100x, 100ml

Zadanie 4: N-Lauroylsarcosine solution, 20%, 10ml

Zadanie 5: Phenol red solution, 0.5%, 100ml

Zadanie 6: Drabina DNA 50bp – standard wielkości do elektroforezy DNA

Zadanie 7: Dithiothreitol solution 1M, 10 ml

Zadanie 8: Woda do biologii molekularnej, 6L (w opakowaniach po max 1L)

Zadanie 9: Qiagen HotStarTaq Plus Master Mix Kit (1000)

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 18.06.2015 r

numer ogłoszenia 7/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania

odczynniki do analiz genetycznych anty-inhibitor PCR

  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

  1. Propozycja wybory oferty najkorzystniejszej : BLIRT S.A., ul. Trzy Lipy 3/1.38,80-172 Gdańsk
  2. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  3. Wykonawca, któremu udzielono zamówienia :

BLIRT S.A., ul. Trzy Lipy 3/1.38,80-172 Gdańsk

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 18.06.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

    Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 03.06.2015 r

numer ogłoszenia 6/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania

  1. Zadanie 1: 22 oligonukleotydy znakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Barwnik (Dye)

Oczyszczanie

Skala syntezy

Bg16F

gTCATTAgTgCTgTCTgTCTATCT

D2

RP1

2OD

TTT1F

GCAGTCCAGCCTTATTTCA

D3

RP1

2OD

TuT2F

CCGTGTCAAGTTCTCCAAAC

D3

RP1

2OD

Bg12F

TCTCCTTCTAAACCAgTCATTC

D4

RP1

2OD

TuT1F

GGTCTACATTTGGCTCTGACC

D2

RP1

2OD

TuT4F

GAGCATCTCCCAGAGTCAGC

D2

RP1

2OD

TuT3F

CAGGAGGCCTCAACTAATCACC

D4

RP1

2OD

Bg18F

CCATAACTTAACTTgCACTTTC

D3

RP1

2OD

Bg14F

ATCCTACTgAACAAAATATCTgC

D2

RP1

2OD

Bg10F

ATgTTTCATgTCTTCTggAATAg

D3

RP1

2OD

Bg15F

AAATATgTTTgCTAgggCTTAC

D3

RP1

2OD

TuD5F

CCTTGCTGCACATTTTCTCC

D4

RP1

2OD

TuD4F

TTAGCAACCGCAGTGATGTG

D3

RP1

2OD

Cypg01F

ACTGAGTATTGATGACTGCTGC

D2

RP1

2OD

Cypg05F

GCTTCTGGAGGAGCATCATG

D3

RP1

2OD

Cypg06F

GGCTAAAGAGGACAACGGTG

D3

RP1

2OD

Cypg19F

AGTGGCCTAATGTCCTAAACC

D2

RP1

2OD

Cypg23F

AGCAAACCTGGCCTTAACTATG

D4

RP1

2OD

Cypg29F

AAGTCCTAAGCCCAAACACC

D2

RP1

2OD

Cypg30F

AGGTTCTGGCTGTAGGTAGAC

D3

RP1

2OD

Cypg31F

CTGCCATACTTCTGCCATGC

D4

RP1

2OD

Zadanie 2: 22 oligonukleotydy nieznakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Oczyszczanie

Skala syntezy

Uwagi

Bg16R

TgCTAggTAgggTAAAAATgg

RP1

0.05μmol

suche

1 probówka

TTT1R

TCAGTGCTTCACTAACCTCTT

RP1

0.05μmol

suche

1 probówka

TuT2R

TTCAAAGCTGTGTTTCATTAGTTG

RP1

0.05μmol

suche

1 probówka

Bg12R

TAgTTTCCACAgAgCACATTg

RP1

0.05μmol

suche

1 probówka

TuT1R

ATATGGCATCCCAGCTATGG

RP1

0.05μmol

suche

1 probówka

TuT4R

TGTGAACCAGCAATCTGAGC

RP1

0.05μmol

suche

1 probówka

TuT3R

CGATGCTGGACAGAAGTGAC

RP1

0.05μmol

suche

1 probówka

Bg18R

CTgATACAAAgATgCCTACAA

RP1

0.05μmol

suche

1 probówka

Bg14R

TATgCAggTAggTAgTgAgAgAg

RP1

0.05μmol

suche

1 probówka

Bg10R

ATTTggTTAgTAACgCATAAgC

RP1

0.05μmol

suche

1 probówka

Bg15R

TACATTTTTCATTgTggACTTC

RP1

0.05μmol

suche

1 probówka

TuD5R

GGTGCTGAGCATGTACTAGGG

RP1

0.05μmol

suche

1 probówka

TuD4R

GGGAGGACTGTGTAGGAGAGC

RP1

0.05μmol

suche

1 probówka

Cypg01R

ATTCTGGAGTCACACGCATG

RP1

0.05μmol

suche

1 probówka

Cypg05R

TCAGTCCTCCAAGAACCCAG

RP1

0.05μmol

suche

1 probówka

Cypg06R

TGCACCAGGGGAGGTTTAGAC

RP1

0.05μmol

suche

1 probówka

Cypg19R

TGGTTAGGGATTCTGTTGCTTG

RP1

0.05μmol

suche

1 probówka

Cypg23R

GGTAGTGGTCTGCAGCTTAATG

RP1

0.05μmol

suche

1 probówka

Cypg29R

CTATGCAAGGAAGGGTACAG

RP1

0.05μmol

suche

1 probówka

Cypg30R

TGACTGCTGAAACTGGCAAC

RP1

0.05μmol

suche

1 probówka

Cypg31R

GATGCCTGTACAAGCAACTG

RP1

0.05μmol

suche

1 probówka

Cypg33R

GACGACTTGCACTGACAGAG

RP1

0.05μmol

suche

1 probówka

  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr  1 i 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

W PLN

Cena brutto

W PLN

1.

Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

4360,84

5363,83

2.

Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

448,80

552,02

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1i 2: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1 i 2: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1ii 2: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 03.06.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

    Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 03.06.2015 r

numer ogłoszenia 3/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

  1. Zadanie 1: 28 oligonukleotydów niemodyfikowanych i modyfikowanych (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)
  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

TABELA DOSTĘPNA W PEŁNEJ WERSJII OGŁOSZENIA : LINK

 

Zadanie nr

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

2442,86 zł

3004,72  zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 03.06.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

    Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Subcategories

Search

Ads

Tender

Institutions