foto Piotr Ślipiński

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 25.05.2015r.

numer ogłoszenia 6/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 22 oligonukleotydy znakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Barwnik (Dye)

Oczyszczanie

Skala syntezy

Bg16F

gTCATTAgTgCTgTCTgTCTATCT

D2

RP1

2OD

TTT1F

GCAGTCCAGCCTTATTTCA

D3

RP1

2OD

TuT2F

CCGTGTCAAGTTCTCCAAAC

D3

RP1

2OD

Bg12F

TCTCCTTCTAAACCAgTCATTC

D4

RP1

2OD

TuT1F

GGTCTACATTTGGCTCTGACC

D2

RP1

2OD

TuT4F

GAGCATCTCCCAGAGTCAGC

D2

RP1

2OD

TuT3F

CAGGAGGCCTCAACTAATCACC

D4

RP1

2OD

Bg18F

CCATAACTTAACTTgCACTTTC

D3

RP1

2OD

Bg14F

ATCCTACTgAACAAAATATCTgC

D2

RP1

2OD

Bg10F

ATgTTTCATgTCTTCTggAATAg

D3

RP1

2OD

Bg15F

AAATATgTTTgCTAgggCTTAC

D3

RP1

2OD

TuD5F

CCTTGCTGCACATTTTCTCC

D4

RP1

2OD

TuD4F

TTAGCAACCGCAGTGATGTG

D3

RP1

2OD

Cypg01F

ACTGAGTATTGATGACTGCTGC

D2

RP1

2OD

Cypg05F

GCTTCTGGAGGAGCATCATG

D3

RP1

2OD

Cypg06F

GGCTAAAGAGGACAACGGTG

D3

RP1

2OD

Cypg19F

AGTGGCCTAATGTCCTAAACC

D2

RP1

2OD

Cypg23F

AGCAAACCTGGCCTTAACTATG

D4

RP1

2OD

Cypg29F

AAGTCCTAAGCCCAAACACC

D2

RP1

2OD

Cypg30F

AGGTTCTGGCTGTAGGTAGAC

D3

RP1

2OD

Cypg31F

CTGCCATACTTCTGCCATGC

D4

RP1

2OD

Cypg33F

AGTCGGGTACTCATCACAGC

D2

RP1

2OD

Zadanie 2: 22 oligonukleotydy nieznakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Oczyszczanie

Skala syntezy

Uwagi

Bg16R

TgCTAggTAgggTAAAAATgg

RP1

0.05μmol

suche

1 probówka

TTT1R

TCAGTGCTTCACTAACCTCTT

RP1

0.05μmol

suche

1 probówka

TuT2R

TTCAAAGCTGTGTTTCATTAGTTG

RP1

0.05μmol

suche

1 probówka

Bg12R

TAgTTTCCACAgAgCACATTg

RP1

0.05μmol

suche

1 probówka

TuT1R

ATATGGCATCCCAGCTATGG

RP1

0.05μmol

suche

1 probówka

TuT4R

TGTGAACCAGCAATCTGAGC

RP1

0.05μmol

suche

1 probówka

TuT3R

CGATGCTGGACAGAAGTGAC

RP1

0.05μmol

suche

1 probówka

Bg18R

CTgATACAAAgATgCCTACAA

RP1

0.05μmol

suche

1 probówka

Bg14R

TATgCAggTAggTAgTgAgAgAg

RP1

0.05μmol

suche

1 probówka

Bg10R

ATTTggTTAgTAACgCATAAgC

RP1

0.05μmol

suche

1 probówka

Bg15R

TACATTTTTCATTgTggACTTC

RP1

0.05μmol

suche

1 probówka

TuD5R

GGTGCTGAGCATGTACTAGGG

RP1

0.05μmol

suche

1 probówka

TuD4R

GGGAGGACTGTGTAGGAGAGC

RP1

0.05μmol

suche

1 probówka

Cypg01R

ATTCTGGAGTCACACGCATG

RP1

0.05μmol

suche

1 probówka

Cypg05R

TCAGTCCTCCAAGAACCCAG

RP1

0.05μmol

suche

1 probówka

Cypg06R

TGCACCAGGGGAGGTTTAGAC

RP1

0.05μmol

suche

1 probówka

Cypg19R

TGGTTAGGGATTCTGTTGCTTG

RP1

0.05μmol

suche

1 probówka

Cypg23R

GGTAGTGGTCTGCAGCTTAATG

RP1

0.05μmol

suche

1 probówka

Cypg29R

CTATGCAAGGAAGGGTACAG

RP1

0.05μmol

suche

1 probówka

Cypg30R

TGACTGCTGAAACTGGCAAC

RP1

0.05μmol

suche

1 probówka

Cypg31R

GATGCCTGTACAAGCAACTG

RP1

0.05μmol

suche

1 probówka

Cypg33R

GACGACTTGCACTGACAGAG

RP1

0.05μmol

suche

1 probówka

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 20.05.2015r.

numer ogłoszenia 4/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 3 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 2 op.

Zadanie 3: CEQ Size Standard 600, nr kat. 608095, 1 op.

Zadanie 4: CEQ Separation Buffer, nr kat. 608012, 2 op.

Zadanie 5: Sample Loading Solution 6.0 mL, nr kat. 608082, 3 op.

Zadanie 6: NucleoSpin® Tissue na 250 izolacji, nr kat. 740 952.250, 1 op.

Zadanie 7: QIAGEN Multiplex PCR Kit (100), nr kat. 206143, 1 op.

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 21.05.2015r.

numer ogłoszenia 3/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 28 oligonukleotydów niemodyfikowanych i modyfikowanych (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

 

Tabela w pełnej wersji pdf.

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 20.05.2015 r.

numer ogłoszenia 2/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 1 op. NucleoSpin®Tissue 50 izolacji MACHEREY-NAGEL 740 952.50

Zadanie 2: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie 3: 2 op. CEQ Separation Gel LPA Beckman Coulter 608010

Zadanie 4: 3 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

Zadanie 5: 2 op. Sample Loading Solution Beckman Coulter 608082

Zadanie 6: 2 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Subcategories

Search

Ads

Tender

Institutions