foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 05.11.2014 r.

numer ogłoszenia 9/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 13 op. CEQ Separation Gel LPA Beckman Coulter 608010

        Zadanie 2: 7 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

        Zadanie 3: 10 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

   Zadanie 4: 11 op. Sample Loading Solution Beckman Coulter 608082

   Zadanie 5: 1 op. Agaroza o wysokiej rozdzielczości DNA, 500 g

   Zadanie 6: 10 szt. Oligonukleotydów, skala syntezy: 0,2 µmol; metoda oczyszczania: odsalanie; zawieszone  w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

Msca43_R

GCTACCGTAGTTAGCTGTTAC

Msca64_R

ACGCGGACGATGTCACGTGC

Msca7_R

AAAGGCGATTAAACGTGGTG

Msca47_R

GAGTAACGGGCCGTTTGTACG

Msca78_R

GGCAAACACGGCACCATGG

Myrt4_R

CGGCGATGCAAGTACGTC

Msca50_R

AGGTAGCGGCTAGCGTGTT

MS86_R

AGTCGTGAGTACAACAT

Msca1_R

CCCGCATTCGCATAGAAATA

MP84_R

AAAGGACAAACGGGAGACGAAC

 

Zadanie 7: 10 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

 

Nazwa

Sekwencja 5'-3'

Msca43_F

[D2]- CGACCGCGCACTTAATCGCG

Msca64_F

[D3]- GTTATCGTCACTATTACTGTCGC

Msca7_F

[D2]- GCTTTAATTCCGGGACACTC

Msca47_F

[D4]- GAACTGGATGCAAAGAGGCGC

Msca78_F

[D3]- CGGGTTAACGTGTTACTGGAG

Myrt4_F

[D3]- CGTGCATGCGAGCATTCCGT

Msca50_F

[D2]- AGCAACGCCACGCGTTACC

MS86_F

[D4]- GATAGCAGATAAAACGA

Msca1_F

[D3]- ACCAGGAAATGAGCCAACAG

MP84_F

[D2]- GCAGTTTAGGCGAGGCTCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

                               

Oryginał do pobrania: TUTAJ

acrobat Zawiadomienie o wyborze Dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie

Konkurs na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN
w Warszawie
na 4-letnią kadencję

 

Działając na podstawie art. 28 ust. 4 punktu 3) ustawy  z dnia  30 kwietnia 2010 r. o Polskiej Akademii Nauk (Dz. U. nr 96  poz. 619) w powiązaniu z § 2 ust. 1 oraz § 14 ust. 1 rozporządzenia  Ministra Nauki i Szkolnictwa Wyższego z dnia  22 listopada 2010 r.  w sprawie konkursu na stanowisko dyrektora instytutu naukowego Polskiej Akademii Nauk  Rada Kuratorów Wydziału II Nauk Biologicznych i Rolniczych  PAN ogłasza  konkurs na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie.

Konkurs składa się z dwóch etapów obejmujących:
1. ocenę formalną zgłoszeń do konkursu oraz ocenę kwalifikacji naukowych /zawodowych kandydatów na podstawie przedstawionych dokumentów;
2.  ocenę wiedzy i predyspozycji kandydatów do kierowania instytutem na podstawie rozmowy kwalifikacyjnej.

WYMAGANIA NIEZBĘDNE:

Kandydatem na stanowisko Dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie może być osoba, która:

  1. posiada co najmniej stopień naukowy doktora nauk biologicznych lub pokrewnych oraz specjalność i znaczący dorobek naukowy w zakresie zoologii;
  2. ma  doświadczenie na stanowisku kierowniczym w sektorze naukowym;
  3. nie była skazana prawomocnym wyrokiem za umyślne przestępstwo lub przestępstwo skarbowe;
  4. korzysta z pełni praw publicznych.

ZGŁOSZENIE KANDYDATA ZAWIERA:

  1. koncepcję funkcjonowania Instytutu opracowaną  przez osobę przystępującą do konkursu w formie prezentacji multimedialnej, złożoną na nośniku elektronicznym;
  2. informację o dotychczasowym przebiegu pracy  zawodowej, w tym o zakresie obowiązków związanych z zajmowanymi stanowiskami i pełnionymi  funkcjami,   okresie ich pełnienia, liczbie podległych pracowników i osiągnięciach zawodowych oraz o posiadanych tytułach lub stopniach naukowych, złożoną   na piśmie w 2 egz.  oraz na nośniku elektronicznym;
  3. poświadczone za zgodność z oryginałem kopie dokumentów potwierdzających:

                  a) przebieg pracy zawodowej;
b) posiadany tytuł lub stopień naukowy;
4.  oświadczenie, że z chwilą objęcia funkcji dyrektora Instytutu, Muzeum i Instytut Zoologii PAN w Warszawie będzie pierwszym miejscem pracy kandydata;
5.   oświadczenie o korzystaniu z pełni praw publicznych;
6.   oświadczenie o niekaralności za umyślne przestępstwo lub przestępstwo skarbowe;
7.   oświadczenie, o którym mowa w art. 7 ust. 1 ustawy z dnia 18 października 2006 r.     o ujawnianiu informacji o dokumentach organów bezpieczeństwa państwa z lat 1944 – 1990 oraz treści tych dokumentów (Dz. U. z 2007 r. Nr 63, poz. 425, z późn. zmianami); 
8.  poświadczoną za zgodność z oryginałem kopię dowodu osobistego lub innego dokumentu potwierdzającego tożsamość,
9.  oświadczenie o wyrażeniu zgody na przetwarzanie danych osobowych w ramach konkursu na stanowisko dyrektora, zgodnie z ustawą z dnia 29 sierpnia 1997 r. o ochronie danych osobowych (Dz.U. nr 133, poz. 883 z późn. zm.)

 

Dokumenty należy nadsyłać  pocztą (w dwóch egzemplarzach) na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Plac Defilad 1 (tel/fax  22 620 33 75) z dopiskiem na kopercie: konkurs na stanowisko dyrektora Muzeum Instytut Zoologii PAN  lub składać osobiście na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Pałac Kultury i Nauki, pokój 2112 (21 piętro) w godz. od 9.00  do 16.00.

Zgłoszenia niekompletne, nie spełniające warunków formalnych oraz przekazane po terminie nie podlegają rozpatrzeniu. O dalszych etapach konkursu kandydaci zostaną powiadomieni pisemnie.

Materiały informacyjne dotyczące funkcjonowania i działalności Muzeum i Instytutu Zoologii PAN w Warszawie dostępne są na stronie internetowej http://www.miiz.waw.pl

 

Ogłoszenie o konkursie opublikowano w dniu 21 listopada 2011 r.
Termin składania zgłoszeń do konkursu wynosi 30 dni liczonych od dnia następującego po dniu ukazania się ogłoszenia o konkursie. O zachowaniu terminu zgłoszenia decyduje data wpływu zgłoszenia.

 

Konkurs na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN
w Warszawie
na 4-letnią kadencję rozpoczynającą się w dniu 1 grudnia 2011 r.

Działając na podstawie art. 28 ust. 4 punktu 3) ustawy  z dnia  30 kwietnia 2010 r. o Polskiej Akademii Nauk (Dz. U. nr 96  poz. 619) w powiązaniu z  § 2 ust. 1 rozporządzenia  Ministra Nauki i Szkolnictwa Wyższego z dnia  22 listopada 2010 r.  w sprawie konkursu na stanowisko dyrektora instytutu naukowego Polskiej Akademii Nauk  Komisja Konkursowa powołana przez Radę Kuratorów Wydziału II Nauk Biologicznych i Rolniczych PAN ogłasza nabór kandydatów na stanowisko dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie.

Konkurs składa się z dwóch etapów obejmujących:
1. ocenę formalną zgłoszeń do konkursu oraz ocenę kwalifikacji naukowych /zawodowych kandydatów na podstawie przedstawionych dokumentów;
2.  ocenę wiedzy i predyspozycji kandydatów do kierowania instytutem na podstawie rozmowy kwalifikacyjnej.

WYMAGANIA NIEZBĘDNE:

Kandydatem na stanowisko Dyrektora Muzeum i Instytutu Zoologii PAN w Warszawie może być osoba, która:

  1. posiada co najmniej stopień naukowy doktora nauk biologicznych lub pokrewnych oraz specjalność i znaczący dorobek naukowy w zakresie zoologii;
  2. ma  doświadczenie na stanowisku kierowniczym w sektorze naukowym;
  3. nie była skazana prawomocnym wyrokiem za umyślne przestępstwo lub przestępstwo skarbowe;
  4. korzysta z pełni praw publicznych.

ZGŁOSZENIE KANDYDATA ZAWIERA:

  1. koncepcję funkcjonowania Instytutu opracowaną  przez osobę przystępującą do konkursu w formie prezentacji multimedialnej, złożoną na nośniku elektronicznym;
  2. informację o dotychczasowym przebiegu pracy  zawodowej, w tym o zakresie obowiązków związanych z zajmowanymi stanowiskami i pełnionymi  funkcjami,   okresie ich pełnienia, liczbie podległych pracowników i osiągnięciach zawodowych oraz o posiadanych tytułach lub stopniach naukowych, złożoną   na piśmie w 2 egz.  oraz na nośniku elektronicznym;
  3. poświadczone za zgodność z oryginałem kopie dokumentów potwierdzających:

                  a) przebieg pracy zawodowej;
b) posiadany tytuł lub stopień naukowy;
4.  oświadczenie, że z chwilą objęcia funkcji dyrektora Instytutu, Muzeum i Instytut Zoologii PAN w Warszawie będzie pierwszym miejscem pracy kandydata;
5.   oświadczenie o korzystaniu z pełni praw publicznych;
6.   oświadczenie o niekaralności za umyślne przestępstwo lub przestępstwo skarbowe;
7.   oświadczenie, o którym mowa w art. 7 ust. 1 ustawy z dnia 18 października 2006 r.     o ujawnianiu informacji o dokumentach organów bezpieczeństwa państwa z lat 1944 – 1990 oraz treści tych dokumentów (Dz. U. z 2007 r. Nr 63, poz. 425, z późn. zmianami);  
8.  poświadczoną za zgodność z oryginałem kopię dowodu osobistego lub innego dokumentu potwierdzającego tożsamość,
9.  oświadczenie o wyrażeniu zgody na przetwarzanie danych osobowych w ramach konkursu na stanowisko dyrektora, zgodnie z ustawą z dnia 29 sierpnia 1997 r. o ochronie danych osobowych (Dz.U. nr 133, poz. 883 z późn. zm.)

 

Dokumenty należy nadsyłać  pocztą (w dwóch egzemplarzach) na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Plac Defilad 1 (tel/fax  22 620 33 75) z dopiskiem na kopercie: konkurs na stanowisko dyrektora Muzeum Instytut Zoologii PAN  lub składać osobiście na adres: Wydział II Nauk Biologicznych i Rolniczych PAN, 00-901 Warszawa, Pałac Kultury i Nauki, pokój 2112 (21 piętro) w godz. od 9.00  do 16.00.

Zgłoszenia niekompletne, nie spełniające warunków formalnych oraz przekazane po terminie nie podlegają rozpatrzeniu. O dalszych etapach konkursu kandydaci zostaną powiadomieni pisemnie.

Materiały informacyjne dotyczące funkcjonowania i działalności Muzeum i Instytutu Zoologii PAN w Warszawie dostępne są na stronie internetowej http://www.miiz.waw.pl

 

Ogłoszenie o konkursie opublikowano w dniu 6 września 2011 r.
Termin składania zgłoszeń do konkursu wynosi 30 dni liczonych od dnia następującego po dniu ukazania się ogłoszenia o konkursie. O zachowaniu terminu zgłoszenia decyduje data wpływu zgłoszenia.

 

Subcategories

Search

Ads

Tender

Institutions

 

Instytucje

 

fauna europaea

fundacja na rzecz nauki polskiej


  

 

vibrant