foto Piotr Ślipiński

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 04.11.2014 r.

numer ogłoszenia 3/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII       

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie  1: 1 op. Taq PCR Master Mix (2x) EURx E2520-03

Zadanie  2: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie  3: 3 op. CEQ Separation Gel LPA Beckman Coulter 608010

Zadanie  4: 3 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

Zadanie  5: 4 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

Zadanie  6: 3 op. Sample Loading Solution Beckman Coulter 608082

Zadanie  7: 1 op. GeneRuler™ 100bp DNA Ladder, 1000 applic Thermo Scientific SM0242

Zadanie  8: 53 szt. Oligonukleotydów – skala syntezy: 0,025 lub 0,02 µmol; metoda oczyszczania:  odsalanie; zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

Str60INRA_F

CGGTGTGCTTGTCAGGTTTC

Str73INRA_F

CCTGGAGATCCTCCAGCAGGA

SsoSL417_F

TTGTTCAGTGTATATGTGTCCCAT

Ssa410Uos_F

GGAAAATAATCAATGCTGCTGGTT

Ssa408Uos_F

AATGGATTACGGGTACGTTAGACA

SsaD190_F

GGCATTGGAGGTAAGGACAC

SSsp2213_F

ATGTGGAGGTCAACTAACCAGCGTG

OMM1064_F

AGAATGCTACTGGTGGCTGTATTGTGA

SsaD71_F

AACGTGAAACATAAATCGATGG

Str60INRA_R

GTCAAGTCAGCAAGCCTCAC

Str73INRA_R

CTATTCTGCTTGTAACTAGACCTA

SsoSL417_R

GATCTTCACTGCCACCTTATGACC

Ssa410Uos_R

CTACAATCTGGACTATCTTCTTCA

Ssa408Uos_R

CTCTTGTGCAGGTTCTTCATCTGT

SsaD190_R

CCAGACCACTGAACTTCTCATC

SSsp2213_R

CATCAATCACAGAGTGAGGCACTCG

OMM1064_R

TCTGAAAGACAGGTGGATGGTTCC

SsaD71_R

TTAAGAATGGGTTGCCTATGAG

BM757_R

TTGAGCCACCAAGGAACC

BM4513_R

TCAGCAATTGAACCAACTTCA

CSSM43_R

GTTACAAATTTAAGAGACAGAGTT

CSSM66_R

ACACAAATCCTTTCTGCCAGCTGA

IDVGA37_R

CCTCTCTTTCTCTATGCTCACA

ILSTS6_R

ACACGGAAGCGATCTAAACG

INRA107_R

GGAGAGCCGAGGGCTTCAGC

INRA40_R

CTCTGCCCTGGGGATGATTG

INRA121_R

CTTCACTATTCCCCACAAAGC

RM12_R

ACTGGGAACCAAGGACTGTCA

RM188_R

GCACTATTGGGCTGGTGATT

TGLA53_R

ATCTTCACATGATATTACAGCAGA

TGLA10_R

CTAAATTTATCCCACTGTGGCTCTT

TGLA127_R

ACACTATTGCAAAAGGACCTCCAATT

Nyc3H

TAGAATHTCAGCTTTGGGTGYTSAKG

Nyc4H

ACDGARAADCCVCCTCARATTCA

Nyc824L

TRTTYGCCTAYGCYATCCT

Nyc840L

YCTWCGATCAATYCCCAAYAA

Nyc1H

CCCTTYKYYGGTTTACAAGAC

Nyc371L

TAGCMACYGCYTTYATAGG

Nyc953H

CGGAAKRTYATGCTTCGTTG

HippH1

CATCARGAKATRCTTGA

HippL1

CCGTTGTATTTCAACTATAAGAACA

Nyc5H

CAGAGAAACCACCTCAGATTCAT

Nyc2L

ATCTGTCGAGACGTAAACTACGG

glo7L

CAYCGTTGTATTTCAACTRTAAGAAC

glo6H

CGGTGTAATGRATATACTACATRG

glo1L

GTCCTGCCATGWGGACAAATATC

glo5L

CCAGAYCTYCTAGGAGAYCCAG

L14724

CGAAGCTTGATATGAAAAACCATCGTTG

H15260

GCGAAGAATCGWGTKAGKGTRGCTTT

L15171

CATGAGGACAAATATCATTCTGAGG

H15915

AACTGCAGTCATCTCCGGTTTACAAGAC

RAG2F220

GATTCCTGCTAYCTYCCTCCTCT

RAG2R995

CCCATGTTGCTTCCAAACCATA

 

   Zadanie  9: 1 op. Anty-inhibitor PCR RP-50 (100 reakcji) DNA-GDAŃSK

Zadanie 10: 14 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

 

Nazwa

Sekwencja 5'-3'

BM757_F

[D2]-TGGAAACAATGTAAACCTGGG

BM4513_F

[D3]-GCGCAAGTTTCCTCATGC

CSSM43_F

[D3]-AAAACTCTGGGAACTTGAAAACTA

CSSM66_F

[D3]-AATTTAATGCACTGAGGAGCTTGG

IDVGA37_F

[D4]-TAACAGGACAAGTCTTCAGGTG

ILSTS6_F

[D4]-TGTCTGTATTTCTGCTGTGG

INRA107_F

[D3]-TCCCAGATACAGATGCAACAG

INRA40_F

[D4]-TCAGTCTGGAGGAGAGAAAAC

INRA121_F

[D3]-GGAAACCCATTGGAGGATTTG

RM12_F

[D2]-CTGAGCTCAGGGGTTTTTGCT

RM188_F

[D2]-GGGTTCACAAAGAGCTGGAC

TGLA53_F

[D2]-GCTTTCAGAAATAGTTTGCATTCA

TGLA10_F

[D2]-CAATCTGCAGTAGCATACATCCTTG

TGLA127_F

[D4]-CAATTGTGTGGTAGTTTGGACATTC

 

   Zadanie  11: 1 op. NucleoSpin®Soil 50 izolacji MACHEREY-NAGEL740 780.50

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 31.10.2014 r.

numer ogłoszenia 7/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: 1 op. NucleoSpin®Tissue 50 izolacji MACHEREY-NAGEL740 952.50

Zadanie 2: 1 op. Anty-inhibitor PCR RP-51 (500 reakcji) DNA-GDAŃSK

Zadanie 3: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie 4: 2 op. CEQ Separation Gel LPA Beckman Coulter 608010

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa odczynników służących wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

 

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 30.10.2014 r.

numer ogłoszenia 8/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

- 40 szt. Oligonukleotydów – skala syntezy: 0,025 lub 0,02 µmol; metoda oczyszczania: odsalanie; zawieszone w wodzie w stężeniu 100 µM

 

Nazwa

Sekwencja 5'-3'

hsp-6a_F 

TCGTCCATCTTTCAACCGTT

hsp-6a_R

AACAGATTGTCTAATTGCTGGAG

hsp-6b_F

GGTGATGCTTGGATTGAGACA

hsp-6b _R

TGGAGAGATCAAAGGTGCCT

hsp-6c_F

AATGGTGATGCTTGGATTGAG

hsp-6c_R

CCTCCACCCAGATTGATGAC

hsp-6d_F

TCTTCTAATGGTGATGCTTGGA

hsp-6d_R

TGCCTCCACCCAGATTGAT

hsp-12.1_ F

GCCTCTCCAGCATAATGACG

hsp-12.1_R

CGATTTATTTCACGACTGACTGA

hsp-43a_ F

CTGGTAGAGGAACAACAGCT

hsp-43a _R

CGGCGGAAATGTGATTCAGA

hsp-43b_ F

CGTAGAGAAGAATTCCGTGAAGA

hsp-43b_R

TTCAGAGCGGTGACTTCCA

hsp-43c_F

AGAGGAACAACAGCTTCAGA

hsp-43c_R

CTGTACGGCGGAAATGTGAT

hsp-43d_F

GAGGAACAACAGCTTCAGATTAT

hsp-43d _R

GCTGTACGGCGGAAATGT

hsp-60a _F

TTCCTGCTCTTGAATTGGCTA

hsp-60a_R

CGTCTTGGATTTGAGCGATT

hsp-60b_ F

TTCCTGCTCTTGAATTGGCT

hsp-60b_R

AATTGTGACTTCATCCGCCT

hsp-60c_F

GGCTAACAAATACCGAAGACCA

hsp-60c_R

GCCGCGCAGAATTAGAGTAT

hsp-60d_ F

CCTGCTCTTGAATTGGCTAAC

hsp-60d_R

CGCGCAGAATTAGAGTATCGT

hsp-110a_F

GATGTGCTCTTCGTTCTGCA

hsp-110a_R

GCCACCTTTCCTTCACACTT

hsp-110b_F

GCTGCTAGGAATAAAGGAATTGG

hsp-110b_R

TGCACCAAAGCCCATAAGTC

hsp-110c_ F

TGCTCTTCGTTCTGCAATGT

hsp-110c_R

TAAGGCAAGAAAGTCGCGTT

hsp-110d_F

TGCAAGAGGATGTGCTCTTC

hsp-110d_R

AGAAAGTCGCGTTTCTTCGG

hsp-16a­_F

ACTTTACCACTATTTCCGTCCAGC

hsp-16a­­­_R

CCTTGAACCGCTTCTTTCTTTG

hsp-16.1a _F

GCTTCAAATCTTTCAGAAGATGG

hsp-16.1a _R 

CAGAAGTTTTTTGTTCAACGGGC

hsp-12.1a_ F

GCCCCTTCAGCATAACGATG

hsp-12.1a_R

ACCTCACGATTGACGATTCC

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                                                                                       (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                              zamówieniu z dziedziny nauki

 

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 30.10.2014 r.

numer ogłoszenia 6/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie nr 1: 2 op. Taq DNA Polymerase recombinant (Thermo Scientific – Fermentas) NR kat. EP0402

Zadanie nr 2: 1op. 2mM dNTP Mix (Thermo Scientific – Fermentas) Nr. Kat. R0242

Zadanie nr 3: 1op. GeneRuler™ 100bp DNA Ladder, ready-to-use Nr. Kat. SM0243

Zadanie nr 4: 1op. 6X Loading Dye Solution (Thermo Scientific – Fermentas) Nr. Kat. R0611

Zadanie nr  5: 1op. 10X TBE Electrophoresis Buffer (Thermo Scientific – Fermentas) Nr. Kat. B52

Zadanie nr 6: 1op. Midori Green Advance DNA Stain Nr. Kat. MG04

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa odczynników służących wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                                                                                    (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia 

o udzielanym zamówieniu z dziedziny nauki

 

Treść do pobrania: TUTAJ

Subcategories

Search

Ads

Tender

Institutions