foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 03.06.2015 r

numer ogłoszenia 6/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania

  1. Zadanie 1: 22 oligonukleotydy znakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Barwnik (Dye)

Oczyszczanie

Skala syntezy

Bg16F

gTCATTAgTgCTgTCTgTCTATCT

D2

RP1

2OD

TTT1F

GCAGTCCAGCCTTATTTCA

D3

RP1

2OD

TuT2F

CCGTGTCAAGTTCTCCAAAC

D3

RP1

2OD

Bg12F

TCTCCTTCTAAACCAgTCATTC

D4

RP1

2OD

TuT1F

GGTCTACATTTGGCTCTGACC

D2

RP1

2OD

TuT4F

GAGCATCTCCCAGAGTCAGC

D2

RP1

2OD

TuT3F

CAGGAGGCCTCAACTAATCACC

D4

RP1

2OD

Bg18F

CCATAACTTAACTTgCACTTTC

D3

RP1

2OD

Bg14F

ATCCTACTgAACAAAATATCTgC

D2

RP1

2OD

Bg10F

ATgTTTCATgTCTTCTggAATAg

D3

RP1

2OD

Bg15F

AAATATgTTTgCTAgggCTTAC

D3

RP1

2OD

TuD5F

CCTTGCTGCACATTTTCTCC

D4

RP1

2OD

TuD4F

TTAGCAACCGCAGTGATGTG

D3

RP1

2OD

Cypg01F

ACTGAGTATTGATGACTGCTGC

D2

RP1

2OD

Cypg05F

GCTTCTGGAGGAGCATCATG

D3

RP1

2OD

Cypg06F

GGCTAAAGAGGACAACGGTG

D3

RP1

2OD

Cypg19F

AGTGGCCTAATGTCCTAAACC

D2

RP1

2OD

Cypg23F

AGCAAACCTGGCCTTAACTATG

D4

RP1

2OD

Cypg29F

AAGTCCTAAGCCCAAACACC

D2

RP1

2OD

Cypg30F

AGGTTCTGGCTGTAGGTAGAC

D3

RP1

2OD

Cypg31F

CTGCCATACTTCTGCCATGC

D4

RP1

2OD

Zadanie 2: 22 oligonukleotydy nieznakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Oczyszczanie

Skala syntezy

Uwagi

Bg16R

TgCTAggTAgggTAAAAATgg

RP1

0.05μmol

suche

1 probówka

TTT1R

TCAGTGCTTCACTAACCTCTT

RP1

0.05μmol

suche

1 probówka

TuT2R

TTCAAAGCTGTGTTTCATTAGTTG

RP1

0.05μmol

suche

1 probówka

Bg12R

TAgTTTCCACAgAgCACATTg

RP1

0.05μmol

suche

1 probówka

TuT1R

ATATGGCATCCCAGCTATGG

RP1

0.05μmol

suche

1 probówka

TuT4R

TGTGAACCAGCAATCTGAGC

RP1

0.05μmol

suche

1 probówka

TuT3R

CGATGCTGGACAGAAGTGAC

RP1

0.05μmol

suche

1 probówka

Bg18R

CTgATACAAAgATgCCTACAA

RP1

0.05μmol

suche

1 probówka

Bg14R

TATgCAggTAggTAgTgAgAgAg

RP1

0.05μmol

suche

1 probówka

Bg10R

ATTTggTTAgTAACgCATAAgC

RP1

0.05μmol

suche

1 probówka

Bg15R

TACATTTTTCATTgTggACTTC

RP1

0.05μmol

suche

1 probówka

TuD5R

GGTGCTGAGCATGTACTAGGG

RP1

0.05μmol

suche

1 probówka

TuD4R

GGGAGGACTGTGTAGGAGAGC

RP1

0.05μmol

suche

1 probówka

Cypg01R

ATTCTGGAGTCACACGCATG

RP1

0.05μmol

suche

1 probówka

Cypg05R

TCAGTCCTCCAAGAACCCAG

RP1

0.05μmol

suche

1 probówka

Cypg06R

TGCACCAGGGGAGGTTTAGAC

RP1

0.05μmol

suche

1 probówka

Cypg19R

TGGTTAGGGATTCTGTTGCTTG

RP1

0.05μmol

suche

1 probówka

Cypg23R

GGTAGTGGTCTGCAGCTTAATG

RP1

0.05μmol

suche

1 probówka

Cypg29R

CTATGCAAGGAAGGGTACAG

RP1

0.05μmol

suche

1 probówka

Cypg30R

TGACTGCTGAAACTGGCAAC

RP1

0.05μmol

suche

1 probówka

Cypg31R

GATGCCTGTACAAGCAACTG

RP1

0.05μmol

suche

1 probówka

Cypg33R

GACGACTTGCACTGACAGAG

RP1

0.05μmol

suche

1 probówka

  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr  1 i 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

W PLN

Cena brutto

W PLN

1.

Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

4360,84

5363,83

2.

Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

448,80

552,02

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1i 2: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1 i 2: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1ii 2: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 03.06.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

    Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 03.06.2015 r

numer ogłoszenia 3/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

  1. Zadanie 1: 28 oligonukleotydów niemodyfikowanych i modyfikowanych (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)
  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

TABELA DOSTĘPNA W PEŁNEJ WERSJII OGŁOSZENIA : LINK

 

Zadanie nr

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

2442,86 zł

3004,72  zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1: Sigma Aldrich, ul. Szelągowska 30, 61-626 Poznań

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 03.06.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

    Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 03.06.2015 r

numer ogłoszenia 4/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 3 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 2 op.

Zadanie 3: CEQ Size Standard 600, nr kat. 608095, 1 op.

Zadanie 4: CEQ Separation Buffer, nr kat. 608012, 2 op.

Zadanie 5: Sample Loading Solution 6.0 mL, nr kat. 608082, 3 op.

Zadanie 6: NucleoSpin® Tissue na 250 izolacji, nr kat. 740 952.250, 1 op.

Zadanie 7: QIAGEN Multiplex PCR Kit (100), nr kat. 206143, 1 op.

  1. Liczba złożonych ofert : 5

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr 1, 2, 3, 4, 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska Sp. Z.o.o., 03-699 Warszawa, ul. Wolińska 4

3167,67 zł

3896,22 zł

 

Zadania nr 6

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

AQUA LAB, 03-194 Warszawa, ul. Zabłocka 10

2035,58 zł

2503,76 zł

3.

Bionovo 59-220 Legnica, ul Rataja 30

2390,00 zł

2939,70 zł

 

Zadanie nr 7

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

ALAB-Gen, 00-703 Warszawa, ul. Kątna 17

965,40 zł

1042,63 zł

5.

Prospecta. 04-511 Warszawa, ul. Barbórki 8

1100,00 zł

1353,00 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1, 2, 3, 4, 5:Comesa Polska Sp. Z.o.o., 03-699 Warszawa, ul. Wolińska 4

- w zakresie zadań nr 6: AQUA LAB, 03-194 Warszawa, ul. Zabłocka 10

- w zakresie zadań nr 7: ALAB-Gen, 00-703 Warszawa, ul. Kątna 17

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1, 2, 3, 4, 5: jedyna złożona oferta uznana za najkorzystniejszą;

      - w zakresie zadań 6, 7: oferta z najniższą ceną uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1, 2, 3, 4, 5: Comesa Polska Sp. Z.o.o., 03-699 Warszawa, ul. Wolińska 4. Data udzielenia zamówienia 03.06.2015 r.

- w zakresie zadań nr 6: AQUA LAB, 03-194 Warszawa, ul. Zabłocka 10. Data udzielenia zamówienia 03.06.2015 r.

- w zakresie zadania nr 7: ALAB-GEN Sp. z o.o.,  ul. Kątna 17, 00-703 Warszawa. Data udzielenia zamówienia 03.06.2015 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 03.06.2015 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

 

Zawiadomienie o zmianie ogłoszenia

o udzieleniu zamówienia z dziedziny nauki z dnia 29.05.2015 r

numer ogłoszenia 2/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

Zamawiający po otrzymaniu informacji, od wybranego Wykonawcy, o jego uchyleniu się od wykonania zadania nr 2 dot. zamówienia DA-2201-132-15-BIP-2 – zawiadamia
o zmianie wyboru Wykonawcy w zadaniu nr 2.

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa 2 op. QIAGEN Multiplex PCR Kit 100 206143 – zadanie nr 2

  1. Liczba złożonych ofert : 4

Zestawienie złożonych ofert dla zadania nr 2 wraz z podaniem cen

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Prospecta Sp. z o.o.

ul. Barbórki 8

04-511 warszawa

Wykonawca uchylił się od realizacji zadania

3.

ALAB-GEN Sp. z o.o.

ul. Kątna 17

00-703 Warszawa

1 851,80 zł

 1 999,94 zł

5.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

2 360,00 zł

2 902,80 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadania nr 2: ALAB-GEN Sp. z o.o.

   ul. Kątna 17

   00-703 Warszawa

     

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

      - w zakresie zadania 2: oferta z najniższą ceną uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : ------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadania nr 2 ALAB-GEN Sp. z o.o., ul. Kątna 17, 00-703 Warszawa. Data udzielenia  zamówienia: 03.06.2015 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 03.06.2015 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Subcategories