foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 17.11.2014 r

numer ogłoszenia 6/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie nr 1: 2 op. Taq DNA Polymerase recombinant (Thermo Scientific – Fermentas) nr kat. EP0402

Zadanie nr 2: 1 op. 2mM dNTP Mix (Thermo Scientific – Fermentas) nr. kat. R0242

Zadanie nr 3: 1 op. GeneRuler™ 100bp DNA Ladder, ready-to-use nr. kat. SM0243

Zadanie nr 4: 1 op. 6X Loading Dye Solution (Thermo Scientific – Fermentas) nr. kat. R0611

Zadanie nr 5: 1 op. 10X TBE Electrophoresis Buffer (Thermo Scientific – Fermentas) nr. kat. B52

Zadanie nr 6: 1 op. Midori Green Advance DNA Stain nr. kat. MG04

 

  1. 5.       Liczba złożonych ofert : 1

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

 ABO Sp. z o.o.

 ul. Wichrowe Wzgórze 123

 80-293 Gdańsk

 

1 437,50 PLN/ 1 699,35 PLN

 

  1. 6.       Propozycja wybory oferty najkorzystniejszej : oferta nr 1
  2. 7.       Uzasadnienie wyboru oferty najkorzystniejszej : jedyna złożona oferta
  3. 8.       Uzasadnienie odrzucenia oferty (o ile dotyczy) : nie dotyczy
  4. 9.       Wykonawca, któremu udzielono zamówienia:

      Nazwa (firma) lub imię i nazwisko: ABO Sp. z o.o.

 

 

Adres Wykonawcy: ul. Wichrowe Wzgórze 123, 80-293 Gdańsk

Data udzielenia zamówienia: 17.11.2014 r.

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

 

 

    Warszawa, dnia 17.11.2014 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

 

Oryginał do pobrania: TUTAJ

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 14.11.2014 r.

numer ogłoszenia 5/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl

3. Rodzaj zamówienia:            dostawy [ X] usługi [  ]

 

4. Opis przedmiotu zamówienia/zakres zamówienia:

Zestaw(y) do amplifikacji całego transkryptomu na 50 próbek.

 

  1. Liczba złożonych ofert: 2

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

Syngen Biotech Sp. z o.o. 54-116 Wrocław ul. Ostródzka 13

6052,00 zł/7443,96 zł

2.

Sigma-Aldrich Sp.z o.o. 61-626 Poznań ul. Szelągowska 30

10802,04 zł netto

 

  1. Propozycja wybory oferty najkorzystniejszej – oferta nr .1
  2. Uzasadnienie wyboru oferty najkorzystniejszej : najniższa cena
  3. Uzasadnienie odrzucenia oferty (o ile dotyczy) : nie dotyczy
  4. Wykonawca, któremu udzielono zamówienia:

Nazwa (firma) lub imię i nazwisko: Syngen Biotech Sp. z o.o.

Adres Wykonawcy: 54-116 Wrocław , ul. Ostródzka 13

.

Data udzielenia zamówienia: 14.11.2014 r.

 

 

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [ X]   NIE  [   ]

 

 

 Warszawa,  dnia 14.11.2014 r.

      (miejscowość)

 

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 12.11.2014 r.

numer ogłoszenia 10/2014

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. 1.     Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII               

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby Grantu wewnętrznego Gwiazda 2014 - Adam Krupski w podziale na zadania:

 

  Zadanie nr 1: (20 szt. Oligonukleotydów – skala syntezy: 0,2 µmol; metoda oczyszczania: odsalanie; liofilizowane lub zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja

Tryp763

CATATGCTTGTTTCAAGGAC

Tryp1016

CCCCATAATCTCCAATGGAC

Tryp99

TCAATCAGACGTAATCTGCC

Tryp957

CTGCTCCTTTGTTATCCCAT

HepF300

GTTTCTGACCTATCAGCTTTCGACG

Hep900

CAAATCTAAGAATTTCACCTCTGAC

Hep1615R

AAAGGGCAGGGACGTAATC

Hep800F

GTCAGAGGTGAAATTCTTAGATTTG

HaemNFI

CATATATTAAGAGAAITATGGAG

HaemNR3

ATAGAAAGATAAGAAATACCATTC

HaemFL

ATGGTGTTTTAGATACTTACATT

HaemR2L

CATTATCTGGATGAGATAATGGIGC

Atox16S1

AAGTATAAGCTTTTATACGGCT

Atox16S2

CACTGCCACGGTAGTCCAATAC

Atox23S1

TACCCGCTGAACTTAAGC

Atox23S2

CMACCAAGATCTGCACTAG

COX tenella F4

G(AT)TCATTAGTATGGGCACATC A

COX tenella R

CCAAGAGATAATAC(AG)AA(AG)TGG AA

COX tenella F2

GGGCACATCATATGATGAC

COX tenella R2

ATAGTATGTATCATGTA(AG)(AT)GCAA

 

      Zadanie nr 2 Końcówki z filtrem do pipet automatycznych 1-10µl 1x96, 10op. Nr. kat 2-001-96-0

      Zadanie nr 3 Końcówki z filtrem do pipet automatycznych 1-200µl 1x96, 4op  Nr. kat 2-113-96-0

      Zadanie nr 4 Końcówki z filtrem do pipet automatycznych 1000µl 1x96, 2op  Nr. kat 2-201-96-0

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Załączniki:

Oryginał ogłoszenia w wersji PDF

Formularz oferty wykonawcy w postępowaniu

 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 28.10.2014

numer ogłoszenia 2/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

 

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

 

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby grantu badawczego Narodowego Centrum Nauki „Dlaczego płazy w miastach zanikają? Wpływ gradientu  urbanizacyjnego na wybrane parametry demograficzne populacji dwóch gatunków płazów: ropuchy zielonej (Bufo viridis) i ropuchy szarej (Bufo bufo).” (nr rej. N N304 335839) w podziale na zadania:

Zadanie 2: Fiolet krezylu (barwnik) – 1 op 10g, nr katalogowy produktu C5042-10G

Zadanie 3: Kwas mrówkowy 98 - 100%   1 litr, nr katalogowy produktu 27001-1L-R

 

5. Liczba złożonych ofert:  1

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

Sigma-Aldrich Sp. z o.o.,

Szelągowska 30 61-626 Poznań

Tel: 061 829 01 00

Fax: 061 829 01 20

828,33/1018,85

 

  1. 6.    Propozycja wybory oferty najkorzystniejszej – oferta nr  1

 

  1. 7.    Uzasadnienie wyboru oferty najkorzystniejszej: jedyna złożona oferta

 

 

  1. 8.    Uzasadnienie odrzucenia oferty (o ile dotyczy): nie dotyczy

 

  1. 9.    Wykonawca, któremu udzielono zamówienia:

Nazwa (firma) lub imię i nazwisko: Sigma-Aldrich Sp. z o.o.

Adres Wykonawcy: ul. Szelągowska 30 61-626 Poznań

Data udzielenia zamówienia: 06.11.2014r.

 

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

 

 

Warszawa, dnia 06.11.2014 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Subcategories