foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 26.11.2014 r

numer ogłoszenia 3/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: 1 op. Taq PCR Master Mix (2x) EURx E2520-03

Zadanie 2: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie 3: 3 op. CEQ Separation Gel LPA Beckman Coulter 608010

Zadanie 4: 3 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

Zadanie 5: 4 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

Zadanie 6: 3 op. Sample Loading Solution Beckman Coulter 608082

Zadanie 7: 1 op. GeneRuler™ 100bp DNA Ladder, 1000 applic Thermo Scientific SM0242

Zadanie 8: 53 szt. Oligonukleotydów – skala syntezy: 0,025 lub 0,02 µmol; metoda oczyszczania:    odsalanie;  zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

Str60INRA_F

CGGTGTGCTTGTCAGGTTTC

Str73INRA_F

CCTGGAGATCCTCCAGCAGGA

SsoSL417_F

TTGTTCAGTGTATATGTGTCCCAT

Ssa410Uos_F

GGAAAATAATCAATGCTGCTGGTT

Ssa408Uos_F

AATGGATTACGGGTACGTTAGACA

SsaD190_F

GGCATTGGAGGTAAGGACAC

SSsp2213_F

ATGTGGAGGTCAACTAACCAGCGTG

OMM1064_F

AGAATGCTACTGGTGGCTGTATTGTGA

SsaD71_F

AACGTGAAACATAAATCGATGG

Str60INRA_R

GTCAAGTCAGCAAGCCTCAC

Str73INRA_R

CTATTCTGCTTGTAACTAGACCTA

SsoSL417_R

GATCTTCACTGCCACCTTATGACC

Ssa410Uos_R

CTACAATCTGGACTATCTTCTTCA

Ssa408Uos_R

CTCTTGTGCAGGTTCTTCATCTGT

SsaD190_R

CCAGACCACTGAACTTCTCATC

SSsp2213_R

CATCAATCACAGAGTGAGGCACTCG

OMM1064_R

TCTGAAAGACAGGTGGATGGTTCC

SsaD71_R

TTAAGAATGGGTTGCCTATGAG

BM757_R

TTGAGCCACCAAGGAACC

BM4513_R

TCAGCAATTGAACCAACTTCA

CSSM43_R

GTTACAAATTTAAGAGACAGAGTT

CSSM66_R

ACACAAATCCTTTCTGCCAGCTGA

IDVGA37_R

CCTCTCTTTCTCTATGCTCACA

ILSTS6_R

ACACGGAAGCGATCTAAACG

INRA107_R

GGAGAGCCGAGGGCTTCAGC

INRA40_R

CTCTGCCCTGGGGATGATTG

INRA121_R

CTTCACTATTCCCCACAAAGC

RM12_R

ACTGGGAACCAAGGACTGTCA

RM188_R

GCACTATTGGGCTGGTGATT

TGLA53_R

ATCTTCACATGATATTACAGCAGA

TGLA10_R

CTAAATTTATCCCACTGTGGCTCTT

TGLA127_R

ACACTATTGCAAAAGGACCTCCAATT

Nyc3H

TAGAATHTCAGCTTTGGGTGYTSAKG

Nyc4H

ACDGARAADCCVCCTCARATTCA

Nyc824L

TRTTYGCCTAYGCYATCCT

Nyc840L

YCTWCGATCAATYCCCAAYAA

Nyc1H

CCCTTYKYYGGTTTACAAGAC

Nyc371L

TAGCMACYGCYTTYATAGG

Nyc953H

CGGAAKRTYATGCTTCGTTG

HippH1

CATCARGAKATRCTTGA

HippL1

CCGTTGTATTTCAACTATAAGAACA

Nyc5H

CAGAGAAACCACCTCAGATTCAT

Nyc2L

ATCTGTCGAGACGTAAACTACGG

glo7L

CAYCGTTGTATTTCAACTRTAAGAAC

glo6H

CGGTGTAATGRATATACTACATRG

glo1L

GTCCTGCCATGWGGACAAATATC

glo5L

CCAGAYCTYCTAGGAGAYCCAG

L14724

CGAAGCTTGATATGAAAAACCATCGTTG

H15260

GCGAAGAATCGWGTKAGKGTRGCTTT

L15171

CATGAGGACAAATATCATTCTGAGG

H15915

AACTGCAGTCATCTCCGGTTTACAAGAC

RAG2F220

GATTCCTGCTAYCTYCCTCCTCT

RAG2R995

CCCATGTTGCTTCCAAACCATA

Zadanie  9: 1 op. Anty-inhibitor PCR RP-50 (100 reakcji) DNA-GDAŃSK

Zadanie 10: 14 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

Nazwa

Sekwencja 5'-3'

BM757_F

[D2]-TGGAAACAATGTAAACCTGGG

BM4513_F

[D3]-GCGCAAGTTTCCTCATGC

CSSM43_F

[D3]-AAAACTCTGGGAACTTGAAAACTA

CSSM66_F

[D3]-AATTTAATGCACTGAGGAGCTTGG

IDVGA37_F

[D4]-TAACAGGACAAGTCTTCAGGTG

ILSTS6_F

[D4]-TGTCTGTATTTCTGCTGTGG

INRA107_F

[D3]-TCCCAGATACAGATGCAACAG

INRA40_F

[D4]-TCAGTCTGGAGGAGAGAAAAC

INRA121_F

[D3]-GGAAACCCATTGGAGGATTTG

RM12_F

[D2]-CTGAGCTCAGGGGTTTTTGCT

RM188_F

[D2]-GGGTTCACAAAGAGCTGGAC

TGLA53_F

[D2]-GCTTTCAGAAATAGTTTGCATTCA

TGLA10_F

[D2]-CAATCTGCAGTAGCATACATCCTTG

TGLA127_F

[D4]-CAATTGTGTGGTAGTTTGGACATTC

      Zadanie  11: 1 op. NucleoSpin®Soil 50 izolacji MACHEREY-NAGEL740 780.50

 

  1. 5.       Liczba złożonych ofert : 9

Zestawienie złożonych ofert wraz z podaniem cen

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

EURx Sp. z o.o.

ul. Przyrodników 3

80-297 Gdańsk

414,00 zł

509,22 zł

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

EURx Sp. z o.o.

ul. Przyrodników 3

80-297 Gdańsk

oferta odrzucona

4.

Syngen Biotech Sp. z o.o. Sp. K

ul. Ostródzka 13

54-116 Wrocław

1 682,00 zł

1 816,56 zł

5.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

 2 600,00 zł

3 198,00 zł

8.

Prospecta Sp. z o.o.

ul. Barbórki 8

04-511 Warszawa

1 900,00 zł

2 052,00zł

 

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

1 444,90 zł

1 777,23 zł

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

699,90 zł

860,88 zł

 

 

Zadanie nr 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

1 204,10 zł

 1 481,04 zł

 

Zadanie nr 6

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

857,90 zł

1 055,22 zł

 

Zadanie nr 7

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

EURx Sp. z o.o.

ul. Przyrodników 3

80-297 Gdańsk

oferta odrzucona

5.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

 835,00 zł

1 027,05 zł

6.

ABO Sp. z o.o.

ul. Podleśna 6a

80-255 Gdańsk

595,00 zł

731,85 zł

 

Zadanie nr 8

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Syngen Biotech Sp. z o.o. Sp. K

ul. Ostródzka 13

54-116 Wrocław

3 602,50 zł

4 431,08 zł

7.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30,

61-626 Poznań

738,08 zł

907,84 zł

 

Zadanie nr 9

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

3.

BLIRT S.A.

ul. Trzy Lipy 3/1.38

80-172 Gdańsk

174,00 zł

214,02 zł

 

Zadanie nr 10

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

7.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30,

61-626 Poznań

3 264,80 zł

4 015,70 zł

 

Zadanie nr 11

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

EURx Sp. z o.o.

ul. Przyrodników 3

80-297 Gdańsk

          

             oferta odrzucona

 

4.

Syngen Biotech Sp. z o.o. Sp. K

ul. Ostródzka 13

54-116 Wrocław

    517,00 zł

635,91 zł

5.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

    900,00 zł

1 107,00 zł

9.

AQUA LAB A. Sierzputowski

i Wspólnicy Sp. j.

ul. Zabłocka 10

03-194 Warszawa

    640,00 zł

787,20 zł

 

  1. 6.       Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadania nr 1: EURx Sp. z o.o.

    ul. Przyrodników 3

    80-297 Gdańsk

- w zakresie zadań nr 2,11: Syngen Biotech Sp. z o.o. Sp. K

     ul. Ostródzka 13

     54-116 Wrocław

- w zakresie zadań nr  3, 4, 5, 6: Comesa Polska

              ul. Wolińska 4

              03-699 Warszawa

- w zakresie zadania nr 7: ABO Sp. z o.o.

   ul. Podleśna 6a

   80-255 Gdańsk

- w zakresie zadań nr  8 i 10: Sigma-Aldrich Sp. z o.o.

                                           ul. Szelągowska 30,

        61-626 Poznań

- w zakresie zadania nr 9: BLIRT S.A.

   ul. Trzy Lipy 3/1.38

   80-172 Gdańsk

 

 

 

  1. 7.       Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1, 3, 4, 5, 6, 9, 10: jedyna złożona oferta uznana za najkorzystniejszą;

      - w zakresie zadań 2, 7, 8, 11: oferta z najniższą ceną uznana za najkorzystniejszą;

 

  1. 8.       Uzasadnienie odrzucenia oferty (o ile dotyczy) : odrzucono ofertę Wykonawcy EURx Sp. z o.o. w zadaniach nr 2, 7 i 11 – zaoferowano produkty równoważne.
  2. 9.       Wykonawca, któremu udzielono zamówienia :

- w zakresie zadania nr 1: EURx Sp. z o.o.,  ul. Przyrodników 3, 80-297 Gdańsk. Data udzielenia  zamówienia: 26.11.2014 r.

- w zakresie zadań nr 2,11: Syngen Biotech Sp. z o.o. Sp. K., ul. Ostródzka 13, 54-116 Wrocław. Data udzielenia zamówienia: 26.11.2014 r.

- w zakresie zadań nr  3, 4, 5, 6:Comesa Polska, ul. Wolińska 4, 03-699 Warszawa. Data udzielenia zamówienia: 26.11.2014 r.

- w zakresie zadania nr 7: ABO Sp. z o.o., ul. Podleśna 6a, 80-255 Gdańsk. Data udzielenia zamówienia: 26.11.2014 r.

- w zakresie zadań nr 8 i 10: Sigma-Aldrich Sp. z o.o.,  ul. Szelągowska 30, 61-626 Poznań. Data udzielenia zamówienia: 26.11.2014 r.

- w zakresie zadania nr 9: BLIRT S.A.,  ul. Trzy Lipy 3/1.38,  80-172 Gdańsk. Data udzielenia zamówienia: 26.11.2014 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 26.11.2014 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Oryginał do pobrania : TUTAJ

 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 12.11.2014

numer ogłoszenia 10/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

 

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

 

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby Grantu wewnętrznego Gwiazda 2014 - Adam Krupski w podziale na zadania:

 

      Zadanie nr 2 Końcówki z filtrem do pipet automatycznych 1-10µl 1x96, 10op. Nr. kat 2-001-96-0

      Zadanie nr 3 Końcówki z filtrem do pipet automatycznych 1-200µl 1x96, 4op  Nr. kat 2-113-96-0

      Zadanie nr 4 Końcówki z filtrem do pipet automatycznych 1000µl 1x96, 2op  Nr. kat 2-201-96-0

5. Liczba złożonych ofert:  2

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

BioSpace Mariusz Piotrowski

Poznań 61-619, ul. Naramowicka 144

Tel/Fax: 795 115 038

e-mail: This email address is being protected from spambots. You need JavaScript enabled to view it.

301,90/326,05

2.

Medlab-Products Sp. z o.o.

05-090 Raszyn

Ul. Gałczyńskiego 8

513,00/554,04

 

 

  1. 6.    Propozycja wybory oferty najkorzystniejszej – oferta nr  1

 

  1. 7.    Uzasadnienie wyboru oferty najkorzystniejszej: najniższa oferta cenowa

 

  1. 8.    Uzasadnienie odrzucenia oferty (o ile dotyczy): nie dotyczy

 

  1. 9.    Wykonawca, któremu udzielono zamówienia:

BioSpace Mariusz Piotrowski

Poznań 61-619, ul. Naramowicka 144

Tel/Fax: 795 115 038

e-mail: This email address is being protected from spambots. You need JavaScript enabled to view it.

 

Data udzielenia zamówienia: 21.11.2014r.

 

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

 

 

Warszawa, dnia 21.11.2014 r.

      (miejscowość, data)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

 

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 12.11.2014

numer ogłoszenia 10/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

 

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

 

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby Grantu wewnętrznego Gwiazda 2014 - Adam Krupski w podziale na zadania:

 

 Zadanie nr 1: (20 szt. Oligonukleotydów – skala syntezy: 0,2 µmol; metoda oczyszczania: odsalanie; liofilizowane lub zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja

Tryp763

CATATGCTTGTTTCAAGGAC

Tryp1016

CCCCATAATCTCCAATGGAC

Tryp99

TCAATCAGACGTAATCTGCC

Tryp957

CTGCTCCTTTGTTATCCCAT

HepF300

GTTTCTGACCTATCAGCTTTCGACG

Hep900

CAAATCTAAGAATTTCACCTCTGAC

Hep1615R

AAAGGGCAGGGACGTAATC

Hep800F

GTCAGAGGTGAAATTCTTAGATTTG

HaemNFI

CATATATTAAGAGAAITATGGAG

HaemNR3

ATAGAAAGATAAGAAATACCATTC

HaemFL

ATGGTGTTTTAGATACTTACATT

HaemR2L

CATTATCTGGATGAGATAATGGIGC

Atox16S1

AAGTATAAGCTTTTATACGGCT

Atox16S2

CACTGCCACGGTAGTCCAATAC

Atox23S1

TACCCGCTGAACTTAAGC

Atox23S2

CMACCAAGATCTGCACTAG

COX tenella F4

G(AT)TCATTAGTATGGGCACATC A

COX tenella R

CCAAGAGATAATAC(AG)AA(AG)TGG AA

COX tenella F2

GGGCACATCATATGATGAC

COX tenella R2

ATAGTATGTATCATGTA(AG)(AT)GCAA

 

5. Liczba złożonych ofert:  2

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

Genomed S.A.

Ul. Ponczowa 12, 02-971 Warszawa

Tel: +48 22 644 60 19

Fax: +48 22 644 60 25

660,00/811,80

2.

Instytut Biochemii i Biofizyki PAN

Ul.Pawińskiego 5A, 02-106 Warszawa

Tel: 22 592 34 02

Fax: 22 592 21 90

924,00/1136,52

 

 

  1. 6.    Propozycja wybory oferty najkorzystniejszej – oferta nr  1

 

  1. 7.    Uzasadnienie wyboru oferty najkorzystniejszej: najniższa oferta cenowa

 

  1. 8.    Uzasadnienie odrzucenia oferty (o ile dotyczy): nie dotyczy

 

  1. 9.    Wykonawca, któremu udzielono zamówienia:

Genomed S.A.

Ul. Ponczowa 12, 02-971 Warszawa

Tel: +48 22 644 60 19

Fax: +48 22 644 60 25

 

Data udzielenia zamówienia: 21.11.2014r.

 

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

 

 

Warszawa, dnia 21.11.2014 r.

      (miejscowość, data)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                          zamówienia z dziedziny nauki

 

Oryginał do pobrania: TUTAJ 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 20.11.2014 r

numer ogłoszenia 8/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

 Przedmiotem zamówienia jest dostawa 40 szt. oligonukleotydów – skala syntezy: 0,025 lub 0,02 µmol; metoda oczyszczania: odsalanie; zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

hsp-6a_F 

TCGTCCATCTTTCAACCGTT

hsp-6a_R

AACAGATTGTCTAATTGCTGGAG

hsp-6b_F

GGTGATGCTTGGATTGAGACA

hsp-6b _R

TGGAGAGATCAAAGGTGCCT

hsp-6c_F

AATGGTGATGCTTGGATTGAG

hsp-6c_R

CCTCCACCCAGATTGATGAC

hsp-6d_F

TCTTCTAATGGTGATGCTTGGA

hsp-6d_R

TGCCTCCACCCAGATTGAT

hsp-12.1_ F

GCCTCTCCAGCATAATGACG

hsp-12.1_R

CGATTTATTTCACGACTGACTGA

hsp-43a_ F

CTGGTAGAGGAACAACAGCT

hsp-43a _R

CGGCGGAAATGTGATTCAGA

hsp-43b_ F

CGTAGAGAAGAATTCCGTGAAGA

hsp-43b_R

TTCAGAGCGGTGACTTCCA

hsp-43c_F

AGAGGAACAACAGCTTCAGA

hsp-43c_R

CTGTACGGCGGAAATGTGAT

hsp-43d_F

GAGGAACAACAGCTTCAGATTAT

hsp-43d _R

GCTGTACGGCGGAAATGT

hsp-60a _F

TTCCTGCTCTTGAATTGGCTA

hsp-60a_R

CGTCTTGGATTTGAGCGATT

hsp-60b_ F

TTCCTGCTCTTGAATTGGCT

hsp-60b_R

AATTGTGACTTCATCCGCCT

hsp-60c_F

GGCTAACAAATACCGAAGACCA

hsp-60c_R

GCCGCGCAGAATTAGAGTAT

hsp-60d_ F

CCTGCTCTTGAATTGGCTAAC

hsp-60d_R

CGCGCAGAATTAGAGTATCGT

hsp-110a_F

GATGTGCTCTTCGTTCTGCA

hsp-110a_R

GCCACCTTTCCTTCACACTT

hsp-110b_F

GCTGCTAGGAATAAAGGAATTGG

hsp-110b_R

TGCACCAAAGCCCATAAGTC

hsp-110c_ F

TGCTCTTCGTTCTGCAATGT

hsp-110c_R

TAAGGCAAGAAAGTCGCGTT

hsp-110d_F

TGCAAGAGGATGTGCTCTTC

hsp-110d_R

AGAAAGTCGCGTTTCTTCGG

hsp-16a­_F

ACTTTACCACTATTTCCGTCCAGC

hsp-16a­­­_R

CCTTGAACCGCTTCTTTCTTTG

hsp-16.1a _F

GCTTCAAATCTTTCAGAAGATGG

hsp-16.1a _R 

CAGAAGTTTTTTGTTCAACGGGC

hsp-12.1a_ F

GCCCCTTCAGCATAACGATG

hsp-12.1a_R

ACCTCACGATTGACGATTCC

 

  1. 5.       Liczba złożonych ofert: 2

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30,

61-626 Poznań

509,20PLN/ 626,32 PLN

2.

BIONOVO

ul. Rataja 30,

59-220 Legnica

 

1 514,28 PLN/ 1 862,56 PLN

 

  1. 6.       Propozycja wybory oferty najkorzystniejszej: oferta nr 1
  2. 7.       Uzasadnienie wyboru oferty najkorzystniejszej: najniższa cena, zgodnie z kryterium wyboru.
  3. 8.       Uzasadnienie odrzucenia oferty (o ile dotyczy): nie dotyczy
  4. 9.       Wykonawca, któremu udzielono zamówienia:

      Nazwa (firma) lub imię i nazwisko: Sigma-Aldrich Sp. z o.o.

      Adres Wykonawcy: ul. Szelągowska 30, 61-626 Poznań

      Data udzielenia zamówienia: 20.11.2014 r.

  1. 10.        Informacja o nieudzieleniu tego zamówienia:

 Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

 

 

    Warszawa, dnia 20.11.2014 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

 

Subcategories