foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 30.09.2015 r

numer ogłoszenia 24/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

    Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

    Zadanie 1: Zadanie nr 1: 11 szt. oligonukleotydów niemodyfikowanych – skala syntezy: 0,02-0,05 µmol; wydajność syntezy >2 OD; metoda oczyszczania: odsalanie; liofilizowane

Nazwa

Sekwencja 5'-3'

AW-01_R

ACATACCTGGTGCTGAATTT

AW-04_R

CTGCAGCTTGGAGAAGAA

AW-05_R

CACCAGTGAGCCAAGAAG

AW-06_R

TGGAGCTTGTGGGTGTAG

AW-09_R

ATCTGTCAGGTTCACTGAGG

AW-12_R

GGATGATGTCTGGGAAGG

AAR3_R

TTTGGGTTACATCTGAGTGTGC

FHU2_R

GCACAGGTAAATATTTGCTGGGCC

POCC8_R

ATGTAGAGCTCCCATGGTGG

ASE19_R

TCTGCCCATTAGGGAAAAGTC

ASE26_R

AACACCTCCCTGTCCCTGC

 

    Zadanie 2:  11 szt. oligonukleotydów modyfikowanych – skala syntezy: 0,04-0,05 µmol, wydajność syntezy >2 OD, metoda oczyszczania: HPLC; liofilizowane

 

Nazwa

Sekwencja 5'-3'

AW-01_F_Hex

[Hex]- TAGCCTTTTCTGCTAAGTGG

AW-04_F_Hex

[Hex]- TGGCTAACAACACATTTCAG

AW-05_F_6-Fam

[Fam]- TTGTGAAGGTATCCCAAATC

AW-06_F_Cy3

[Cy3]- GCTCCCTCTCTCCTCTTACT

AW-09_F_6-Fam

[Fam]- CATTATGCAAGACCCCAATA

AW-12_F_Cy3

[Cy3]- CATTTGTTGCAGAGATCACA

AAR3_F_6-Fam

[Fam]- GCATCTGGTCTCCGATTGTT

FHU2_F_Hex

[Hex]- GTGTTCTTAAAACATGCCTGGAGG

POCC8_F_Cy3

[Cy3]- GCATGTCTCTTCAGACATCTGC

ASE19_F_6-Fam

[Fam]- TAGGGTCCCAGGGAGGAAG

ASE26_F_Cy3

[Cy3]- GCTGGCCTTGCAAAAACTTC

 

  1. Liczba złożonych ofert : 2

Zestawienie złożonych ofert wraz z podaniem cen

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Pracownia Sekwencjonowania DNA i Syntezy Oligonukleotydów IBB PAN

ul. Pawińskiego 5A

02-971 Warszawa

 239,80 zł

294,95 zł

2.

Genomed  S. A.

ul. Ponczowa 12

02-971 Warszawa

196,00 zł

241,08 zł

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Pracownia Sekwencjonowania DNA i Syntezy Oligonukleotydów IBB PAN

ul. Pawińskiego 5A

02-971 Warszawa

 2 184,53 zł

2 686,97 zł

2.

Genomed  S. A.

ul. Ponczowa 12

02-971 Warszawa

1 730,00 zł

2 127,90 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań 1 i 2:   Genomed  S. A.

ul. Ponczowa 12

02-971 Warszawa

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1 i 2:  oferta z najniższą ceną uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

      - w zakresie zadań 1 i 2: Genomed  S. A. ul. Ponczowa 12 , 02-971 Warszawa. Data udzielenia zamówienia 30.09.2015 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 30.09.2015 r.

             (miejscowość)

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Search

Ads

Tender

Institutions