foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 29.12.2015 r

numer ogłoszenia 38/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

    Przedmiotem zamówienia jest dostawa odczynników do analiz genetycznych z wykorzystaniem    sekwenatora Beckman Coulter, w podziale na zadania:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 6 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 5 op.

Zadanie 3: CEQ Separation Buffer, nr kat. 608012, 2 op.

Zadanie 4: Sample Loading Solution 6.0 mL, nr kat. 608082, 6 op.

Zadanie 5: CEQ Capillary Array, nr kat. 608087, 1 op.

  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

2 160,00 zł

2 656,80 zł

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

1 625,00 zł

1 998,75 zł

 

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

364,00 zł

447,72 zł

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

1 440,00 zł

1 771,20 zł

 

Zadanie nr 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

2 450,00zł

3 013,50 zł

 

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań 1, 2, 3, 4, 5: Comesa Polska

      ul. Wolińska 4

                                                03-699 Warszawa

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1,2, 3, 4, 5: jedyna złożona oferta uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań 1, 2, 3, 4, 5: Comesa Polska, ul. Wolińska 4, 03-366 Warszawa. Data udzielenia zamówienia: 29.12.2015 r.

 10.  Informacja o nieudzieleniu tego zamówienia:

  Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 29.12.2015 r.

             (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 17.12.2015 r.

numer ogłoszenia 38/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania.

Odczynniki do analiz genetycznych z wykorzystaniem sekwenatora Beckman Coulter:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 6 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 5 op.

Zadanie 3: CEQ Separation Buffer, nr kat. 608012, 2 op.

Zadanie 4: Sample Loading Solution 6.0 mL, nr kat. 608082, 6 op.

Zadanie 5: CEQ Capillary Array, nr kat. 608087, 1 op.

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

 

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszeniao udzielanym

 

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 15.12.2015 r.

numer ogłoszenia 37/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

   Przedmiotem zamówienia jest dostawa 33 szt. oligonukleotydów niemodyfikowanych – skala syntezy: 0,02-0,05 µmol; metoda oczyszczania: odsalanie; liofilizowane

Nazwa

Sekwencja 5'-3'

nFABP1fv

AAATCCGTGACCGAACTCAACG

nFABP1rv

GAGGTCTCCCTTCGTCATTGTATG

nHMGA1fv

GCACACAAGGCACTGTGAAGAG

nHMGA1rv

TTCTGGGCAGAGTAATTGTATCGC

nPPARGfv

TGGCAACTTTGCAGCTTGTGC

nPPARGrv

CAACGTTGTAAGGCCACGAACC

nTFRCfv

ACACTTATCCCATTCGGACATGC

nTFRCrv

GTGTGGTTGAATGAAGGGAAGCC

nPPARGC1Afv

TCAGACAAATCACCTGCAAGCC

nPPARGC1Afv

TGGAGACTCAGGTGTCAATGGAAG

TcyF1

TGCATTTCCAGCAGAGC

TcyF2

CTTGCAGTGTCCCTCTAAT

TcyR1

CTTCACTTTCATTTCGCCTTA

TcyR2

GCGGTTCAGGCAAAACT

TprF1

GTCCGACGTACATTCTTCT

TprF2

AGTGGGTGGTTGGCC

TprR1

GCCACCTCGCAACAC

TprR2

CACCGCTCGAACAAGT

TsiF

GCGGGCGGATTGTG

TsiR1

CTCAAAGCTGTACAGACGATT

TsiR2

TGTTGCGGTCCCACA

TspF

GTGCTGACATTGTTCCTGT

TspBR1

AAACCTGCACAATCAAAGGA

TspBR2

CGATCCGGTTGAACCGA

TspAF

GCATAAGGCTGGTCGGG

TspAR

CTCATACCAGCACAGTCAG

TviF

ATCGCAAGACAGTGGGTA

TviR1

ACCTTCAGTGCCACTCATT

TviR2

CCTTCAGTGCCACTCATTAA

TRNAH

TGAATTTTTTATTGTGATTAA

MRH106

AATTTCTAAAGACTTTTCTTAGT

MORF

ATCGGGGTTTAATAATGGG

MTHIS

AAATTCAATTGAAATTAATAGC


 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

 

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 10.12.2015 r.

numer ogłoszenia 40/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest wykonanie usługi wraz z dostawą odczynników w podziale na zadania:

Zadanie 1: Zestaw do zautomatyzowanej izolacji genomowego DNA z kału.

Zadanie 2: Protokół do zautomatyzowanej izolacji genomowego DNA z kału, przy pomocy stacji pipetującej Microlab STAR z programem sterującym Venus two.

 

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

Podkategorie