foto Piotr Ślipiński

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 10.12.2015 r.

numer ogłoszenia 41/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników NucleoSpin® Tissue (250 izolacji) nr kat.: 740 952.250, 1 op.

 

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 07.12.2015 r.

numer ogłoszenia 36/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników chemicznych w podziale na zadania:

Zadanie nr 1: Gliceryna bezwodna cz. 1l

Zadanie nr 2: Octan etylu cz. 2l

Zadanie nr 3: Wodorotlenek potasu cz. 1 kg

Zadanie nr 4: Kwas octowy cz. 80% 1l

Zadanie nr 5: Nadtlenek wodoru cz. 30% 5l

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 04.12.2015 r

numer ogłoszenia 34/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

    Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: 6 op. CEQ Separation Gel LPA Nr kat./ 608010

Zadanie 2: 3 op.SLS (Sample Loading Solution) Nr kat./ 608082

Zadanie 3: 3 op. GeXP DNA Size Standard Kit - 400 Nr kat./ 608098

Zadanie 4: 1 op. CEQ Separation Buffer  Nr kat./ 608012   

Zadanie 5: Color Taq PCR Master Mix 2x, 500 reakcji, Nr kat./: E2525-03

 

5.       Liczba złożonych ofert : 2

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

2 089,14 zł

2 569,64 zł

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

701,15 zł

862,41 zł

 

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

907,20 zł

1 115,86 zł

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

186,02 zł

228,80 zł

 

Zadanie nr 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

EURx Sp. z o.o

ul. Przyrodników 3

80-297 Gdańsk

460,00 zł

565,80 zł

 

6.       Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr  1,2,3,4: Comesa Polska

    ul. Wolińska 4

                                                  03-699 Warszawa

-w zakresie zadania nr 5: EURx Sp. z o.o

  ul. Przyrodników 3

  80-297 Gdańsk

7.       Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1,2, 3, 4, 5: jedyna złożona oferta uznana za najkorzystniejszą;

8.       Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------

9.       Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1, 2, 3, 4: Comesa Polska, ul. Wolińska 4, 03-699 Warszawa.Data udzielenia zamówienia: 04.12.2015 r.

- w zakresie zadania nr 5:EURx Sp. z o.o., ul. Przyrodników 3, 80-297 Gdańsk. Data udzielenia zamówienia 04.12.2015 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 04.12.2015 r.

             (miejscowość)

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszeniao udzieleniu

 

                                                                                                                                             zamówienia z dziedziny nauki

Oryginał do pobrania: TUTAJ

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 23.11.2015 r.

numer ogłoszenia 35/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK                     

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa: 2 oligonukleotydy niemodyfikowane:

Nazwa

Sekwencja 5’ to 3’

Skala syntezy

Oczyszczanie

Modyfikacje 5’

Modyfikacje 3’

PSTwew

TGTAGTAAGAACCGACCAACGA

40 nmol lub 0,05µmol

HPLC

brak

brak

FSTwew

CCCCCTACGCTGAAGGAT

40 nmol lub 0,05µmol

HPLC

brak

Brak

 

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Podkategorie