foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 30.09.2015 r

numer ogłoszenia 24/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

    Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

    Zadanie 1: Zadanie nr 1: 11 szt. oligonukleotydów niemodyfikowanych – skala syntezy: 0,02-0,05 µmol; wydajność syntezy >2 OD; metoda oczyszczania: odsalanie; liofilizowane

Nazwa

Sekwencja 5'-3'

AW-01_R

ACATACCTGGTGCTGAATTT

AW-04_R

CTGCAGCTTGGAGAAGAA

AW-05_R

CACCAGTGAGCCAAGAAG

AW-06_R

TGGAGCTTGTGGGTGTAG

AW-09_R

ATCTGTCAGGTTCACTGAGG

AW-12_R

GGATGATGTCTGGGAAGG

AAR3_R

TTTGGGTTACATCTGAGTGTGC

FHU2_R

GCACAGGTAAATATTTGCTGGGCC

POCC8_R

ATGTAGAGCTCCCATGGTGG

ASE19_R

TCTGCCCATTAGGGAAAAGTC

ASE26_R

AACACCTCCCTGTCCCTGC

 

    Zadanie 2:  11 szt. oligonukleotydów modyfikowanych – skala syntezy: 0,04-0,05 µmol, wydajność syntezy >2 OD, metoda oczyszczania: HPLC; liofilizowane

 

Nazwa

Sekwencja 5'-3'

AW-01_F_Hex

[Hex]- TAGCCTTTTCTGCTAAGTGG

AW-04_F_Hex

[Hex]- TGGCTAACAACACATTTCAG

AW-05_F_6-Fam

[Fam]- TTGTGAAGGTATCCCAAATC

AW-06_F_Cy3

[Cy3]- GCTCCCTCTCTCCTCTTACT

AW-09_F_6-Fam

[Fam]- CATTATGCAAGACCCCAATA

AW-12_F_Cy3

[Cy3]- CATTTGTTGCAGAGATCACA

AAR3_F_6-Fam

[Fam]- GCATCTGGTCTCCGATTGTT

FHU2_F_Hex

[Hex]- GTGTTCTTAAAACATGCCTGGAGG

POCC8_F_Cy3

[Cy3]- GCATGTCTCTTCAGACATCTGC

ASE19_F_6-Fam

[Fam]- TAGGGTCCCAGGGAGGAAG

ASE26_F_Cy3

[Cy3]- GCTGGCCTTGCAAAAACTTC

 

  1. Liczba złożonych ofert : 2

Zestawienie złożonych ofert wraz z podaniem cen

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Pracownia Sekwencjonowania DNA i Syntezy Oligonukleotydów IBB PAN

ul. Pawińskiego 5A

02-971 Warszawa

 239,80 zł

294,95 zł

2.

Genomed  S. A.

ul. Ponczowa 12

02-971 Warszawa

196,00 zł

241,08 zł

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Pracownia Sekwencjonowania DNA i Syntezy Oligonukleotydów IBB PAN

ul. Pawińskiego 5A

02-971 Warszawa

 2 184,53 zł

2 686,97 zł

2.

Genomed  S. A.

ul. Ponczowa 12

02-971 Warszawa

1 730,00 zł

2 127,90 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań 1 i 2:   Genomed  S. A.

ul. Ponczowa 12

02-971 Warszawa

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1 i 2:  oferta z najniższą ceną uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

      - w zakresie zadań 1 i 2: Genomed  S. A. ul. Ponczowa 12 , 02-971 Warszawa. Data udzielenia zamówienia 30.09.2015 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 30.09.2015 r.

             (miejscowość)

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 23.09.2015 r.

numer ogłoszenia 24/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

 

Zadanie nr 1: 11 szt. oligonukleotydów niemodyfikowanych – skala syntezy: 0,02-0,05 µmol; wydajność syntezy >2 OD; metoda oczyszczania: odsalanie; liofilizowane

 

Nazwa

Sekwencja 5'-3'

AW-01_R

ACATACCTGGTGCTGAATTT

AW-04_R

CTGCAGCTTGGAGAAGAA

AW-05_R

CACCAGTGAGCCAAGAAG

AW-06_R

TGGAGCTTGTGGGTGTAG

AW-09_R

ATCTGTCAGGTTCACTGAGG

AW-12_R

GGATGATGTCTGGGAAGG

AAR3_R

TTTGGGTTACATCTGAGTGTGC

FHU2_R

GCACAGGTAAATATTTGCTGGGCC

POCC8_R

ATGTAGAGCTCCCATGGTGG

ASE19_R

TCTGCCCATTAGGGAAAAGTC

ASE26_R

AACACCTCCCTGTCCCTGC

 

Zadanie nr 2: 11 szt. oligonukleotydów modyfikowanych – skala syntezy: 0,04-0,05 µmol, wydajność syntezy >2 OD, metoda oczyszczania: HPLC; liofilizowane

 

Nazwa

Sekwencja 5'-3'

AW-01_F_Hex

[Hex]- TAGCCTTTTCTGCTAAGTGG

AW-04_F_Hex

[Hex]- TGGCTAACAACACATTTCAG

AW-05_F_6-Fam

[Fam]- TTGTGAAGGTATCCCAAATC

AW-06_F_Cy3

[Cy3]- GCTCCCTCTCTCCTCTTACT

AW-09_F_6-Fam

[Fam]- CATTATGCAAGACCCCAATA

AW-12_F_Cy3

[Cy3]- CATTTGTTGCAGAGATCACA

AAR3_F_6-Fam

[Fam]- GCATCTGGTCTCCGATTGTT

FHU2_F_Hex

[Hex]- GTGTTCTTAAAACATGCCTGGAGG

POCC8_F_Cy3

[Cy3]- GCATGTCTCTTCAGACATCTGC

ASE19_F_6-Fam

[Fam]- TAGGGTCCCAGGGAGGAAG

ASE26_F_Cy3

[Cy3]- GCTGGCCTTGCAAAAACTTC

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania TUTAJ

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 15.09.2015 r.

numer ogłoszenia 22/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

 

Zadanie 1: PrepFiler Express BTA™ Forensic DNA Extraction Kit (Applied Biosystems), nr kat: 4441351; 3

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania TUTAJ.

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 10.09.2015 r

numer ogłoszenia 21/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: 3 op. 3500 POP-7TM Polymer Nr kat./ 4393708

Zadanie 2: 2 op. Anode Buffer Container 3500 Series Nr kat./ 4393927

Zadanie 3: 1 op. Cathode buffer container 3500 Series Nr kat./ 4408256

Zadanie 4: 7 op. Conditioning Reagent, 3500 Series Nr kat./ 4393718

Zadanie 5: 1 op  (3000 units lub więcej) Exonuclease I

Zadanie 6:  1 op (2500 units lub więcej) Shrimp alkaline phosphatase

 

  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

 

Zadanie nr 1-4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Life Technologies Polska Sp. z o.o.

Ul.Bonifraterska 17, 00-203 Warszawa

3672,85

4517,61

 

Zadanie nr 5-6

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Lab-JOT Ltd. Sp. z o.o. Sp.k., Al. Jerozolimskie 214, 02-486 Warszawa, tel.(22)3359884/fax (22)3359819, www.labjot.com , Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.

1232,55

1331,15

 

2.

 

 

 

Sigma-Aldrich Spółka z o.o.

Ul.Szelągowska 30, 61-626 Poznań

5567,73

6013,15

 

 

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1-4 Life Technologies Polska Sp. z o.o.

- w zakresie zadań nr 5-6 Lab-JOT Ltd. Sp. z o.o. Sp.k.

 

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań nr 1-4 Life Technologies Polska Sp. z o.o. – jedyna złożona oferta uznana za najkorzystniejszą

- w zakresie zadań nr 5-6 Lab-JOT Ltd. Sp. z o.o. Sp.k. – oferta uznana za najkorzystniejszą

 

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -

 

  1. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1-4 Life Technologies Polska Sp. z o.o. Ul.Bonifraterska 17, 00-203 Warszawa

- w zakresie zadań nr 5-6 Lab-JOT Ltd. Sp. z o.o. Sp.k. Al. Jerozolimskie 214, 02-486 Warszawa

 

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    

Warszawa, dnia 10.09.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

zamówienia z dziedziny nauki

Oryginał do pobrania TUTAJ

Podkategorie