Unia Europejska

foto Piotr Ślipiński

 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 04.10.2016 r.

numer ogłoszenia 13/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 ustawy z dnia 29 stycznia 2004 r Prawo zamówień publicznych (tekst jednolity Dz.U. z 2015 r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia – dostawa odczynników:

 Zadanie nr 1: 1 op. SMRTbell™ Template Prep Kit 1.0 Pacific Biosciences, nr kat. 100-259-100

 Zadanie nr 2: 4 op. DNA Sequencing Reagent 4.0 V2 Pacific Biosciences, nr kat. 100-612-400

 Zadanie nr 3: 2 op. SMRT®Cell 8Pac V3 (8 Cells) Pacific Biosciences nr kat. 100-171-800

 Zadanie nr 4: 1 op. MagBead Kit v2 Pacific Biosciences nr kat. 100-676-500

 

5Liczba złożonych ofert:  1

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

TK Biotech Sp. z o.o.

ul. Królewicza Jakuba 40A

03-366 Warszawa

2 293,01 EUR

2 820,40 EUR

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

TK Biotech Sp. z o.o.

ul. Królewicza Jakuba 40A

03-366 Warszawa

994,00 EUR

1 222,62 EUR

 

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

TK Biotech Sp. z o.o.

ul. Królewicza Jakuba 40A

03-366 Warszawa

2 250,00 EUR

2 767,50 EUR

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

TK Biotech Sp. z o.o.

ul. Królewicza Jakuba 40A

03-366 Warszawa

1 436,00 EUR

1 766,28 EUR

 

6.       Propozycja wybory oferty najkorzystniejszej: oferta nr 1  

  TK Biotech Sp. z o.o.

ul. Królewicza Jakuba 40A

        03-366 Warszawa

7.       Uzasadnienie wyboru oferty najkorzystniejszej: jedyna złożona oferta uznana za najkorzystniejszą

8.       Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------

9.       Wykonawca, któremu udzielono zamówienia :

 -  TK Biotech Sp. z o.o., ul. Królewicza Jakuba 40A,  03-366 Warszawa. Data udzielenia zamówienia:         30.09.2016 r.

10. Informacja o nieudzieleniu tego zamówienia:

 Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 04.10.2016 r.

             (miejscowość)

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 28.09.2016 r.

numer ogłoszenia 15/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 ustawy z dnia 29 stycznia 2004 r Prawo zamówień publicznych (tekst jednolity Dz.U. z 2015 r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia: Przedmiotem zamówienia jest dostawa odczynników w podziale na poniższe zadania:

 

Zadanie 1: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

Mi2F4

ATGAAGCTAAGACTTTGGGCT

 

 Zadanie 2: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

Mi1R1

TCCCGCTACACCCTCAACTTC

 

 Zadanie 3: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

1096F

ggtaattctggagctaatac

 

 Zadanie 4: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

GrosR1-650R

ggccaacgccggggaa

 

 Zadanie 5: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

ITS5

GGAAGTAAAAGTCGTAACAAGG

 

 

 

 Zadanie 6: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

PITSp4

ACAACAGCAATCGTCGAG


 Zadanie 7
: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w   wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

PITSr3

AGCGCAGACATGCCGCAA

 

5.  Liczba złożonych ofert:  2

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

124,66 zł

153,33 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

42,70 zł

52,52 zł

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

124,66 zł

153,33 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

42,70 zł

52,52 zł

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

119,03 zł

146,41 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

42,02 zł

 51,68 zł

 

 

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

96,50 zł

118,70 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

39,30 zł

48,34 zł

Zadanie nr 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

130,29 zł

160,26 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

43,38 zł

53,37 zł

 

Zadanie nr 6

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

107,77 zł

132,56 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

40,66 zł

50,01 zł

 

Zadanie nr 7

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Polgen Sp. z o.o. – Sp. K

ul. Puszkina 80

92-516 Łódź

107,77 zł

132,56 zł

2.

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

40,66 zł

50,01 zł

 

  1. Propozycja wybory oferty najkorzystniejszej: oferta nr 2  

Sigma-Aldrich Sp. z o.o.

ul. Szelągowska 30

61-626 Poznań – w zakresie zadań 1-7.

  1. Uzasadnienie wyboru oferty najkorzystniejszej: oferta uznana za najkorzystniejszą w kryterium ceny;
  2. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  3. Wykonawca, któremu udzielono zamówienia :

 - Sigma-Aldrich Sp. z o.o., ul. Szelągowska 30, 61-626 Poznań. Data udzielenia zamówienia 28.09.2016 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 28.09.2016 r.

             (miejscowość)

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 28.09.2016 r.

numer ogłoszenia 12/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 ustawy z dnia 29 stycznia 2004 r Prawo zamówień publicznych (tekst jednolity Dz.U. z 2015 r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

 Przedmiotem zamówienia jest dostawa odczynników do analiz genetycznych z    wykorzystaniem   sekwenatora Beckman Coulter:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 10 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 8 op.

Zadanie 3: CEQ Separation Buffer, nr kat. 608012, 10 op.

Zadanie 4: Sample Loading Solution 6.0 mL, nr kat. 608082, 7 op.

 

5.  Liczba złożonych ofert:  1

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

3 700,00 zł

4 551,00 zł

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

2 800,00 zł

3 444,00 zł

 

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

1 920,00 zł

2 361,60 zł

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Comesa Polska

ul. Wolińska 4

03-366 Warszawa

1 740,00 zł

2 152,50 zł

 

  1. Propozycja wybory oferty najkorzystniejszej: oferta nr 1  

Comesa Polska

ul. Wolińska 4

       03-699 Warszawa

  1. Uzasadnienie wyboru oferty najkorzystniejszej: jedyna złożona oferta uznana za najkorzystniejszą
  2. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  3. Wykonawca, któremu udzielono zamówienia :

 - Comesa Polska, ul. Wolińska 4, 03-366 Warszawa. Data udzielenia zamówienia: 28.09.2016 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 28.09.2016 r.

             (miejscowość)

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 28.09.2016 r.

numer ogłoszenia 14/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 z dnia 29 stycznia 2004 r Prawo zamówień publicznych (Dz.U. z 2015r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII        

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Marker wielkości GeneRuler™ DNA Ladder, High RangeNr kat./SM1351

 

 

 

Uzasadnienie zastosowania art. 4d ust 1 pkt 1  ustawy PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi