Unia Europejska

foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 20.09.2016 r.

numer ogłoszenia 15/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 z dnia 29 stycznia 2004 r Prawo zamówień publicznych (Dz.U. z 2015r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII        

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

     Przedmiotem zamówienia jest dostawa odczynników w podziale na poniższe zadania:

 

Zadanie 1: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

Mi2F4

ATGAAGCTAAGACTTTGGGCT

 

 Zadanie 2: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

Mi1R1

TCCCGCTACACCCTCAACTTC

 

 Zadanie 3: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

1096F

ggtaattctggagctaatac

 

 Zadanie 4: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

GrosR1-650R

ggccaacgccggggaa

 

 Zadanie 5: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

ITS5

GGAAGTAAAAGTCGTAACAAGG

 

 Zadanie 6: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

PITSp4

ACAACAGCAATCGTCGAG


 Zadanie 7
: 1 szt. Oligonukleotyd – skala syntezy: 0,025 µmol; metoda oczyszczania: HPLC; zawieszony w   wodzie w stężeniu 100 µM.

Nazwa

Sekwencja 5'-3'

PITSr3

AGCGCAGACATGCCGCAA

 

 

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 16.09.2016 r.

numer ogłoszenia 13/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 z dnia 29 stycznia 2004 r Prawo zamówień publicznych (Dz.U. z 2015r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII       

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

   Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie nr 1: 1 op. SMRTbell™ Template Prep Kit 1.0 Pacific Biosciences, nr kat. 100-259-100

Zadanie nr 2: 4 op. DNA Sequencing Reagent 4.0 V2 Pacific Biosciences, nr kat. 100-612-400

Zadanie nr 3: 2 op. SMRT®Cell 8Pac V3 (8 Cells) Pacific Biosciences nr kat. 100-171-800

Zadanie nr 4: 1 op. MagBead Kit v2 Pacific Biosciences nr kat. 100-676-500

 

 

 

 

Uzasadnienie zastosowania art. 4d ust 1 pkt 1  ustawy PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 16.09.2016 r.

numer ogłoszenia 12/2016

 

Podstawa prawna ogłoszenia: art. 4d ust 1 pkt 1 z dnia 29 stycznia 2004 r Prawo zamówień publicznych (Dz.U. z 2015r., poz. 2164 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII        

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na poniższe zadania:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 10 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 8 op.

Zadanie 3: CEQ Separation Buffer, nr kat. 608012, 10 op.

Zadanie 4: Sample Loading Solution 6.0 mL, nr kat. 608082, 7 op.

 

 

 

Uzasadnienie zastosowania art. 4d ust 1 pkt 1  ustawy PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 12.09.2016 r.

numer ogłoszenia 10/2016

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r Prawo zamówień publicznych (Dz.U. z 2015r., poz. 2164) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII        

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników QIAGEN Multiplex PCR Kit (100) nr kat 206143 - 2 op.

 

 

 

 

 

Uzasadnienie zastosowania art. 4d ust 1 pkt 1

 

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki
Oryginał do pobrania: TUTAJ

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi