foto Piotr Ślipiński

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 22.07.2015 r.

numer ogłoszenia 15/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

 

Zadanie 1: NEBNext® DNA Library Prep Master Mix Set for 454™ na 50 reakcji, 1 opakowanie, nr kat: E6070L

Zadanie 2: Qiagen MinElute PCR Purification Kit (250), 2 opakowania, nr kat:28006

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 16.07.2015 r.

numer ogłoszenia 14/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

 

Zadanie 1: 2 oligonukleotydy niemodyfikowane (sekwencje, sposób oczyszczenia oraz skala syntezy podane w załączniku)

Nazwa

Sekwencja 5’ to 3’

Skala syntezy

Oczyszczanie

Modyfikacje 5’

Modyfikacje 3’

PST

CCCAAAGCTAAAATTCTAAAT

40 nmol lub 0,05µmol

HPLC

brak

brak

FST

GCTTTAGTTAAGCTACGC

40 nmol lub 0,05µmol

HPLC

brak

Brak

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 10.07.2015 r.

numer ogłoszenia 13/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

 

Zadanie 1: QIAGEN Multiplex PCR Kit (100) nr kat 206143

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 10.07.2015 r

numer ogłoszenia 11/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

    Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 14 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 8 op.

Zadanie 3: CEQ Separation Buffer, nr kat. 608012, 6 op.

Zadanie 4: Sample Loading Solution 6.0 mL, nr kat. 608082, 7 op.

Zadanie 5: CEQ Capillary Array, nr kat. 608087, 1 op.

Zadanie 6: QIAGEN Multiplex PCR Kit (100), nr kat. 206143, 2 op.

Zadanie 7: 8 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

 

Sekwencja 5'-3'

Msca43_F

[D2]- CGACCGCGCACTTAATCGCG

Msca64_F

[D3]- GTTATCGTCACTATTACTGTCGC

Msca47_F

[D4]- GAACTGGATGCAAAGAGGCGC

Msca78_F

[D3]- CGGGTTAACGTGTTACTGGAG

Myrt4_F

[D3]- CGTGCATGCGAGCATTCCGT

Msca1_F

[D3]- ACCAGGAAATGAGCCAACAG

MP84_F

[D2]- GCAGTTTAGGCGAGGCTCGAC

MP67_F

[D4]-GTTCTCTGAGCTTCTCTCCTAC

 

  1. Liczba złożonych ofert : 3

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadania nr 1, 2, 3, 4, 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

12 615,00 zł

15 516,45 zł

 

Zadanie nr 6

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

3.

ALAB-GEN Sp. z o.o.

ul. Kątna 17

00-703 Warszawa

1 098,36 zł

1 186,23zł

 

Zadanie nr 7

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Sigma-Aldrich sp. z o.o.

ul. Szelągowska 30

61-626 Poznań

1 660,40 zł

2 042,29 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań 1, 2, 3, 4, 5: Comesa Polska

    ul. Wolińska 4

                                             03-699 Warszawa

- w zakresie zadania nr 6: ALAB-GEN Sp. z o.o.

   ul. Kątna 17

   00-703 Warszawa

- w zakresie zadania nr 7: Sigma-Aldrich sp. z o.o.

   ul. Szelągowska 30

   61-626 Poznań

 

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 1,2, 3, 4, 5, 6, 7: jedyna złożona oferta uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań 1, 2, 3, 4, 5: Comesa Polska, ul. Wolińska 4, 03-699 Warszawa. Data udzielenia zamówienia: 10.07.2015 r.

- w zakresie zadania nr 6: ALAB-GEN Sp. z o.o., ul. Kątna 17, 00-703 Warszawa. Data udzielenia  zamówienia: 10.07.2015 r

- w zakresie zadania nr 7: Sigma-Aldrich sp. z o.o.,   ul. Szelągowska 30, 61-626 Poznań. Data udzielenia zamówienia: 10.07.2015 r

 

 10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 10.07.2015 r.

             (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi