foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 29.05.2015 r

numer ogłoszenia 2/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII       

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

    Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: 1 op. NucleoSpin®Tissue 50 izolacji MACHEREY-NAGEL 740 952.50

Zadanie 2: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie 3: 2 op. CEQ Separation Gel LPA Beckman Coulter 608010

Zadanie 4: 3 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

Zadanie 5: 2 op. Sample Loading Solution Beckman Coulter 608082

Zadanie 6: 2 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

 

  1. Liczba złożonych ofert : 5

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

AQUA LAB A. Sierzputowski

i Wspólnicy Sp. j.

ul. Zabłocka 10

03-194 Warszawa

453,16 zł

557,39 zł

5.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

550,00 zł

676,50 zł

 

 

 

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Prospecta Sp. z o.o.

ul. Barbórki 8

04-511 Warszawa

1 100,00 zł

1 353,00 zł

3.

ALAB-GEN Sp. z o.o.

ul. Kątna 17

00-703 Warszawa

1 851,80 zł

1 999,94  zł

5.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

1 180,00 zł

1 451,40 zł

 

Zadanie nr 3

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

712,72 zł

876,64 zł

 

Zadanie nr 4

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

956,55 zł

1 176,55 zł

 

Zadanie nr 5

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

464,74 zł

571,63 zł

 

Zadanie nr 6

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

356,36 zł

438,32 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadania nr 1: AQUA LAB A. Sierzputowski

   i Wspólnicy Sp. j.

   ul. Zabłocka 10

  03-194 Warszawa

- w zakresie zadania nr 2 : Prospecta Sp. z o.o.

                                       ul. Barbórki 8

    04-511 Warszawa

- w zakresie zadań nr  3, 4, 5, 6: Comesa Polska

 ul. Wolińska 4

 03-699 Warszawa

 

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 3, 4, 5, 6: jedyna złożona oferta uznana za najkorzystniejszą;

      - w zakresie zadań1 i 2: oferta z najniższą ceną uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadania nr 1: AQUA LAB A. Sierzputowski i Wspólnicy Sp. j. ul. Zabłocka 10, 03-194 Warszawa. Data udzielenia zamówienia 29.05.2015 r.

- w zakresie zadania nr 2:. Prospecta Sp. z o.o., ul. Barbórki 8, 04-511 Warszawa. Data udzielenia zamówienia: 29.05.2015 r.

- w zakresie zadań nr 3, 4, 5, 6: Comesa Polska, ul. Wolińska 4, 03-699 Warszawa. Data udzielenia zamówienia: 29.05.2015 r.

.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 29.05.2015 r.

             (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 28.05.2015 r

numer ogłoszenia 5/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: NucleoSpin® 96 Tissue na 2 × 96 izolacji, nr kat. 740 741.2, 2 op.

Zadanie 2: Separation Gel - LPAI 10 mL, nr kat. 608010, 10 op.

Zadanie 3: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 8 op.

Zadanie 4: CEQ Size Standard 600, nr kat. 608095, 2 op.

Zadanie 5: CEQ Separation Buffer, nr kat. 608012, 5 op.

Zadanie 6: Sample Loading Solution 6.0 mL, nr kat. 608082, 10 op.

Zadanie 7: CEQ Capillary Array, nr kat. 608087, 2 op.

Zadanie 8: NucleoSpin® Tissue na 250 izolacji, nr kat. 740 952.250, 1 op.

Zadanie 9: NucleoSpin® Soil na 250 izolacji, nr kat. 740 780.250, 2 op.

Zadanie 10: QIAGEN Multiplex PCR Kit (1000), nr kat. 206145, 1 op.

Zadanie 11: QIAGEN Multiplex PCR Kit (100), nr kat. 206143, 1 op.

 

  1. Liczba złożonych ofert : 5

Zestawienie złożonych ofert wraz z podaniem cen

 

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

4 068,82 zł

5 004,65 zł

2.

AQUA LAB A. Sierzputowski

i Wspólnicy Sp. j.

ul. Zabłocka 10

03-194 Warszawa

3 464,50 zł

4 261,34 zł

 

Zadania nr 2, 3, 4, 5, 6, 7

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

3.

Comesa Polska

ul. Wolińska 4

03-699 Warszawa

14 897,47 zł

18 323,89 zł

 

Zadanie nr 8

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

2 390,64 zł

2 940,49 zł

2.

AQUA LAB A. Sierzputowski

i Wspólnicy Sp. j.

ul. Zabłocka 10

03-194 Warszawa

2 035,58 zł

2 503,76 zł

 

Zadanie nr 9

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Aneta Ludwig BIONOVO

ul. Macieja Rataja 30

59-220 Legnica

 7 416,58 zł

9 122,40 zł

2.

AQUA LAB A. Sierzputowski

i Wspólnicy Sp. j.

ul. Zabłocka 10

03-194 Warszawa

6 315,04 zł

7 767,50 zł

 

Zadanie nr 10

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Prospecta Sp. z o.o.

ul. Barbórki 8

04-511 warszawa

8 500,00 zł

 10 455,00 zł

5.

ALAB-GEN Sp. z o.o.

ul. Kątna 17

00-703 Warszawa

8 322,16 zł

8 987,93 zł

 

Zadanie nr 11

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

4.

Prospecta Sp. z o.o.

ul. Barbórki 8

04-511 warszawa

1 100,00 zł

 1 353,00 zł

5.

ALAB-GEN Sp. z o.o.

ul. Kątna 17

00-703 Warszawa

965,40 zł

1 042,63 zł

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1, 8 i 9: AQUA LAB A. Sierzputowski

   i Wspólnicy Sp. j.

   ul. Zabłocka 10

  03-194 Warszawa

- w zakresie zadań nr 2, 3, 4, 5, 6, 7: Comesa Polska

     ul. Wolińska 4

     03-699 Warszawa

- w zakresie zadań nr  10 i 11: ALAB-GEN Sp. z o.o.

                                             ul. Kątna 17

                                             00-703 Warszawa

 

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań 2, 3, 4, 5, 6, 7: jedyna złożona oferta uznana za najkorzystniejszą;

      - w zakresie zadań 1, 8, 9, 10 i 11: oferta z najniższą ceną uznana za najkorzystniejszą;

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------
  2. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1, 8 i 9: AQUA LAB A. Sierzputowski i Wspólnicy Sp. j. ul. Zabłocka 10, 03-194 Warszawa. Data udzielenia zamówienia 28.05.2015 r.

- w zakresie zadań nr 2, 3, 4, 5, 6, 7: Comesa Polska, ul. Wolińska 4, 03-699 Warszawa. Data udzielenia zamówienia: 28.05.2015 r.

- w zakresie zadania nr 10 i 11: ALAB-GEN Sp. z o.o.,  ul. Kątna 17, 00-703 Warszawa. Data udzielenia zamówienia: 28.05.2015 r.

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    Warszawa, dnia 28.05.2015 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 25.05.2015 r.

numer ogłoszenia 1/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: QIAGEN Multiplex Plus PCR Kit (100), Nr kat./ 206143, 3 szt.

Zadanie 2: Qiagen QiaAmp DNA Micro Kit (50), Nr kat./ 56304, 1 op.

Zadanie 3: Qiagen QiaAmp DNA STool mini Kit (50), Nr kat./ 51504, 1 op.

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 25.05.2015r.

numer ogłoszenia 6/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: 22 oligonukleotydy znakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Barwnik (Dye)

Oczyszczanie

Skala syntezy

Bg16F

gTCATTAgTgCTgTCTgTCTATCT

D2

RP1

2OD

TTT1F

GCAGTCCAGCCTTATTTCA

D3

RP1

2OD

TuT2F

CCGTGTCAAGTTCTCCAAAC

D3

RP1

2OD

Bg12F

TCTCCTTCTAAACCAgTCATTC

D4

RP1

2OD

TuT1F

GGTCTACATTTGGCTCTGACC

D2

RP1

2OD

TuT4F

GAGCATCTCCCAGAGTCAGC

D2

RP1

2OD

TuT3F

CAGGAGGCCTCAACTAATCACC

D4

RP1

2OD

Bg18F

CCATAACTTAACTTgCACTTTC

D3

RP1

2OD

Bg14F

ATCCTACTgAACAAAATATCTgC

D2

RP1

2OD

Bg10F

ATgTTTCATgTCTTCTggAATAg

D3

RP1

2OD

Bg15F

AAATATgTTTgCTAgggCTTAC

D3

RP1

2OD

TuD5F

CCTTGCTGCACATTTTCTCC

D4

RP1

2OD

TuD4F

TTAGCAACCGCAGTGATGTG

D3

RP1

2OD

Cypg01F

ACTGAGTATTGATGACTGCTGC

D2

RP1

2OD

Cypg05F

GCTTCTGGAGGAGCATCATG

D3

RP1

2OD

Cypg06F

GGCTAAAGAGGACAACGGTG

D3

RP1

2OD

Cypg19F

AGTGGCCTAATGTCCTAAACC

D2

RP1

2OD

Cypg23F

AGCAAACCTGGCCTTAACTATG

D4

RP1

2OD

Cypg29F

AAGTCCTAAGCCCAAACACC

D2

RP1

2OD

Cypg30F

AGGTTCTGGCTGTAGGTAGAC

D3

RP1

2OD

Cypg31F

CTGCCATACTTCTGCCATGC

D4

RP1

2OD

Cypg33F

AGTCGGGTACTCATCACAGC

D2

RP1

2OD

Zadanie 2: 22 oligonukleotydy nieznakowane (sekwencje, modyfikacje oraz skala syntezy podane w tabeli)

Nazwa

Sekwencja 5'-3'

Oczyszczanie

Skala syntezy

Uwagi

Bg16R

TgCTAggTAgggTAAAAATgg

RP1

0.05μmol

suche

1 probówka

TTT1R

TCAGTGCTTCACTAACCTCTT

RP1

0.05μmol

suche

1 probówka

TuT2R

TTCAAAGCTGTGTTTCATTAGTTG

RP1

0.05μmol

suche

1 probówka

Bg12R

TAgTTTCCACAgAgCACATTg

RP1

0.05μmol

suche

1 probówka

TuT1R

ATATGGCATCCCAGCTATGG

RP1

0.05μmol

suche

1 probówka

TuT4R

TGTGAACCAGCAATCTGAGC

RP1

0.05μmol

suche

1 probówka

TuT3R

CGATGCTGGACAGAAGTGAC

RP1

0.05μmol

suche

1 probówka

Bg18R

CTgATACAAAgATgCCTACAA

RP1

0.05μmol

suche

1 probówka

Bg14R

TATgCAggTAggTAgTgAgAgAg

RP1

0.05μmol

suche

1 probówka

Bg10R

ATTTggTTAgTAACgCATAAgC

RP1

0.05μmol

suche

1 probówka

Bg15R

TACATTTTTCATTgTggACTTC

RP1

0.05μmol

suche

1 probówka

TuD5R

GGTGCTGAGCATGTACTAGGG

RP1

0.05μmol

suche

1 probówka

TuD4R

GGGAGGACTGTGTAGGAGAGC

RP1

0.05μmol

suche

1 probówka

Cypg01R

ATTCTGGAGTCACACGCATG

RP1

0.05μmol

suche

1 probówka

Cypg05R

TCAGTCCTCCAAGAACCCAG

RP1

0.05μmol

suche

1 probówka

Cypg06R

TGCACCAGGGGAGGTTTAGAC

RP1

0.05μmol

suche

1 probówka

Cypg19R

TGGTTAGGGATTCTGTTGCTTG

RP1

0.05μmol

suche

1 probówka

Cypg23R

GGTAGTGGTCTGCAGCTTAATG

RP1

0.05μmol

suche

1 probówka

Cypg29R

CTATGCAAGGAAGGGTACAG

RP1

0.05μmol

suche

1 probówka

Cypg30R

TGACTGCTGAAACTGGCAAC

RP1

0.05μmol

suche

1 probówka

Cypg31R

GATGCCTGTACAAGCAACTG

RP1

0.05μmol

suche

1 probówka

Cypg33R

GACGACTTGCACTGACAGAG

RP1

0.05μmol

suche

1 probówka

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi