foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 11.08.2015 r

numer ogłoszenia 15/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: NEBNext® DNA Library Prep Master Mix Set for 454™ na 50 reakcji, 1 opakowanie, nr kat: E6070L

Zadanie 2: Qiagen MinElute PCR Purification Kit (250), 2 opakowania, nr kat:28006

 

  1. Liczba złożonych ofert : 1

Zestawienie złożonych ofert wraz z podaniem cen

 

 

 

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

2.

Lab-JOT Ltd. Sp. z o.o. Sp.k., Al. Jerozolimskie 214, 02-486 Warszawa, tel.(22)3359884/fax (22)3359819, www.labjot.com , Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.

4709,52

5792,71

 

Zadanie nr 2

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

ALAB-GEN sp. z o.o., ul. Kątna 17, 00-703 Warszawa, Tel: +48 22 349 60 10, Fax: +48 22 349 60 33, email: Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.

4243,86

5219,95

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1 Lab-JOT Ltd. Sp. z o.o. Sp.k.

- w zakresie zadań nr 2 ALAB-GEN sp. z o.o.

 

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań nr 1 Lab-JOT Ltd. Sp. z o.o. Sp.k. – jedyna złożona oferta uznana za najkorzystniejszą

- w zakresie zadań nr 2 ALAB-GEN sp. z o.o. – jedyna złożona oferta uznana za najkorzystniejszą

 

 

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------

 

  1. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1 Lab-JOT Ltd. Sp. z o.o. Sp.k. Al. Jerozolimskie 214, 02-486 Warszawa

- w zakresie zadań nr 2 ALAB-GEN sp. z o.o. ul. Kątna 17, 00-703 Warszawa

 

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    

Warszawa, dnia 11.08.2015 r.

      (miejscowość)

 

..........................................................

                                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

zamówienia z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 05.08.2015r.

numer ogłoszenia 18/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

 

  QIAGEN Multiplex PCR Kit (100) nr kat 206143

 

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 03.08.2015 r

numer ogłoszenia 14/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej): http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia

  Przedmiotem zamówienia jest dostawa:

Zadanie 1: 2 oligonukleotydy niemodyfikowane (sekwencje, sposób oczyszczenia oraz skala syntezy podane w załączniku)

Nazwa

Sekwencja 5’ to 3’

Skala syntezy

Oczyszczanie

Modyfikacje 5’

Modyfikacje 3’

PST

CCCAAAGCTAAAATTCTAAAT

40 nmol lub 0,05µmol

HPLC

brak

brak

FST

GCTTTAGTTAAGCTACGC

40 nmol lub 0,05µmol

HPLC

brak

Brak

 

  1. Liczba złożonych ofert : 1

 

Zadanie nr 1

Numer oferty

Nazwa (firma) i adres wykonawcy

Cena netto

Cena brutto

1.

Sigma Aldrich

ul. Szelągowska 30

61-626 Poznań

tel. 618290100/61

fax 618290120

Ten adres pocztowy jest chroniony przed spamowaniem. Aby go zobaczyć, konieczne jest włączenie w przeglądarce obsługi JavaScript.

111,40

137,02

 

 

  1. Propozycja wybory oferty najkorzystniejszej :

- w zakresie zadań nr 1: Sigma Aldrich

 

  1. Uzasadnienie wyboru oferty najkorzystniejszej :

- w zakresie zadań nr 1: Sigma Aldrich

 

  1. Uzasadnienie odrzucenia oferty (o ile dotyczy) : -----------

 

  1. Wykonawca, któremu udzielono zamówienia :

- w zakresie zadań nr 1: Sigma Aldrich. Data udzielenia zamówienia 03.08.2015r.

 

 

 

 

10. Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

    

Warszawa, dnia 03.08.2015 r.

      (miejscowość)

 

 

 

..........................................................

                                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

zamówienia z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 29.07.2015 r.

numer ogłoszenia 17/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

   Przedmiotem zamówienia jest dostawa: N-Lauroylsarcosine sodium salt solution, 30%, 100 ml, czystość minimalna: ≤97% (HPLC), 1 opakowanie

 

 

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Podkategorie