foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 31.10.2014 r.

numer ogłoszenia 7/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie 1: 1 op. NucleoSpin®Tissue 50 izolacji MACHEREY-NAGEL740 952.50

Zadanie 2: 1 op. Anty-inhibitor PCR RP-51 (500 reakcji) DNA-GDAŃSK

Zadanie 3: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie 4: 2 op. CEQ Separation Gel LPA Beckman Coulter 608010

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa odczynników służących wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                  (podpis osoby upoważnionej

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

 

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 30.10.2014 r.

numer ogłoszenia 8/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

- 40 szt. Oligonukleotydów – skala syntezy: 0,025 lub 0,02 µmol; metoda oczyszczania: odsalanie; zawieszone w wodzie w stężeniu 100 µM

 

Nazwa

Sekwencja 5'-3'

hsp-6a_F 

TCGTCCATCTTTCAACCGTT

hsp-6a_R

AACAGATTGTCTAATTGCTGGAG

hsp-6b_F

GGTGATGCTTGGATTGAGACA

hsp-6b _R

TGGAGAGATCAAAGGTGCCT

hsp-6c_F

AATGGTGATGCTTGGATTGAG

hsp-6c_R

CCTCCACCCAGATTGATGAC

hsp-6d_F

TCTTCTAATGGTGATGCTTGGA

hsp-6d_R

TGCCTCCACCCAGATTGAT

hsp-12.1_ F

GCCTCTCCAGCATAATGACG

hsp-12.1_R

CGATTTATTTCACGACTGACTGA

hsp-43a_ F

CTGGTAGAGGAACAACAGCT

hsp-43a _R

CGGCGGAAATGTGATTCAGA

hsp-43b_ F

CGTAGAGAAGAATTCCGTGAAGA

hsp-43b_R

TTCAGAGCGGTGACTTCCA

hsp-43c_F

AGAGGAACAACAGCTTCAGA

hsp-43c_R

CTGTACGGCGGAAATGTGAT

hsp-43d_F

GAGGAACAACAGCTTCAGATTAT

hsp-43d _R

GCTGTACGGCGGAAATGT

hsp-60a _F

TTCCTGCTCTTGAATTGGCTA

hsp-60a_R

CGTCTTGGATTTGAGCGATT

hsp-60b_ F

TTCCTGCTCTTGAATTGGCT

hsp-60b_R

AATTGTGACTTCATCCGCCT

hsp-60c_F

GGCTAACAAATACCGAAGACCA

hsp-60c_R

GCCGCGCAGAATTAGAGTAT

hsp-60d_ F

CCTGCTCTTGAATTGGCTAAC

hsp-60d_R

CGCGCAGAATTAGAGTATCGT

hsp-110a_F

GATGTGCTCTTCGTTCTGCA

hsp-110a_R

GCCACCTTTCCTTCACACTT

hsp-110b_F

GCTGCTAGGAATAAAGGAATTGG

hsp-110b_R

TGCACCAAAGCCCATAAGTC

hsp-110c_ F

TGCTCTTCGTTCTGCAATGT

hsp-110c_R

TAAGGCAAGAAAGTCGCGTT

hsp-110d_F

TGCAAGAGGATGTGCTCTTC

hsp-110d_R

AGAAAGTCGCGTTTCTTCGG

hsp-16a­_F

ACTTTACCACTATTTCCGTCCAGC

hsp-16a­­­_R

CCTTGAACCGCTTCTTTCTTTG

hsp-16.1a _F

GCTTCAAATCTTTCAGAAGATGG

hsp-16.1a _R 

CAGAAGTTTTTTGTTCAACGGGC

hsp-12.1a_ F

GCCCCTTCAGCATAACGATG

hsp-12.1a_R

ACCTCACGATTGACGATTCC

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

..........................................................

                                                                                                       (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                              zamówieniu z dziedziny nauki

 

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 30.10.2014 r.

numer ogłoszenia 6/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie nr 1: 2 op. Taq DNA Polymerase recombinant (Thermo Scientific – Fermentas) NR kat. EP0402

Zadanie nr 2: 1op. 2mM dNTP Mix (Thermo Scientific – Fermentas) Nr. Kat. R0242

Zadanie nr 3: 1op. GeneRuler™ 100bp DNA Ladder, ready-to-use Nr. Kat. SM0243

Zadanie nr 4: 1op. 6X Loading Dye Solution (Thermo Scientific – Fermentas) Nr. Kat. R0611

Zadanie nr  5: 1op. 10X TBE Electrophoresis Buffer (Thermo Scientific – Fermentas) Nr. Kat. B52

Zadanie nr 6: 1op. Midori Green Advance DNA Stain Nr. Kat. MG04

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa odczynników służących wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

..........................................................

                                                                                                    (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia 

o udzielanym zamówieniu z dziedziny nauki

 

Treść do pobrania: TUTAJ

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 28.10.2014 r.

numer ogłoszenia 2/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 1.     Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII               

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby grantu badawczego Narodowego Centrum Nauki Dlaczego płazy w miastach zanikają? Wpływ gradientu  urbanizacyjnego na wybrane parametry demograficzne populacji dwóch gatunków płazów: ropuchy zielonej (Bufo viridis) i ropuchy szarej (Bufo bufo).” (nr rej. N N304 335839) w podziale na zadania:

 

Zadanie 1: Jung Tissue freezing medium – 6 butelek  , 125 ml, nr katalogowy produktu 14020108926

Zadanie 2: Fiolet krezylu (barwnik) – 1 op 10g, nr katalogowy produktu C5042-10G

Zadanie 3: Kwas mrówkowy 98 - 100%   1 litr, nr katalogowy produktu 27001-1L-R

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

 zamówieniu z dziedziny nauki

 

Treść do pobrania: TUTAJ

Formularz do pobrania: TUTAJ

Podkategorie