foto Piotr Ślipiński

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 14.11.2014 r.

numer ogłoszenia 5/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl

3. Rodzaj zamówienia:            dostawy [ X] usługi [  ]

 

4. Opis przedmiotu zamówienia/zakres zamówienia:

Zestaw(y) do amplifikacji całego transkryptomu na 50 próbek.

 

  1. Liczba złożonych ofert: 2

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

Syngen Biotech Sp. z o.o. 54-116 Wrocław ul. Ostródzka 13

6052,00 zł/7443,96 zł

2.

Sigma-Aldrich Sp.z o.o. 61-626 Poznań ul. Szelągowska 30

10802,04 zł netto

 

  1. Propozycja wybory oferty najkorzystniejszej – oferta nr .1
  2. Uzasadnienie wyboru oferty najkorzystniejszej : najniższa cena
  3. Uzasadnienie odrzucenia oferty (o ile dotyczy) : nie dotyczy
  4. Wykonawca, któremu udzielono zamówienia:

Nazwa (firma) lub imię i nazwisko: Syngen Biotech Sp. z o.o.

Adres Wykonawcy: 54-116 Wrocław , ul. Ostródzka 13

.

Data udzielenia zamówienia: 14.11.2014 r.

 

 

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [ X]   NIE  [   ]

 

 

 Warszawa,  dnia 14.11.2014 r.

      (miejscowość)

 

Oryginał do pobrania: TUTAJ

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 12.11.2014 r.

numer ogłoszenia 10/2014

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. 1.     Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII               

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby Grantu wewnętrznego Gwiazda 2014 - Adam Krupski w podziale na zadania:

 

  Zadanie nr 1: (20 szt. Oligonukleotydów – skala syntezy: 0,2 µmol; metoda oczyszczania: odsalanie; liofilizowane lub zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja

Tryp763

CATATGCTTGTTTCAAGGAC

Tryp1016

CCCCATAATCTCCAATGGAC

Tryp99

TCAATCAGACGTAATCTGCC

Tryp957

CTGCTCCTTTGTTATCCCAT

HepF300

GTTTCTGACCTATCAGCTTTCGACG

Hep900

CAAATCTAAGAATTTCACCTCTGAC

Hep1615R

AAAGGGCAGGGACGTAATC

Hep800F

GTCAGAGGTGAAATTCTTAGATTTG

HaemNFI

CATATATTAAGAGAAITATGGAG

HaemNR3

ATAGAAAGATAAGAAATACCATTC

HaemFL

ATGGTGTTTTAGATACTTACATT

HaemR2L

CATTATCTGGATGAGATAATGGIGC

Atox16S1

AAGTATAAGCTTTTATACGGCT

Atox16S2

CACTGCCACGGTAGTCCAATAC

Atox23S1

TACCCGCTGAACTTAAGC

Atox23S2

CMACCAAGATCTGCACTAG

COX tenella F4

G(AT)TCATTAGTATGGGCACATC A

COX tenella R

CCAAGAGATAATAC(AG)AA(AG)TGG AA

COX tenella F2

GGGCACATCATATGATGAC

COX tenella R2

ATAGTATGTATCATGTA(AG)(AT)GCAA

 

      Zadanie nr 2 Końcówki z filtrem do pipet automatycznych 1-10µl 1x96, 10op. Nr. kat 2-001-96-0

      Zadanie nr 3 Końcówki z filtrem do pipet automatycznych 1-200µl 1x96, 4op  Nr. kat 2-113-96-0

      Zadanie nr 4 Końcówki z filtrem do pipet automatycznych 1000µl 1x96, 2op  Nr. kat 2-201-96-0

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

 

Załączniki:

Oryginał ogłoszenia w wersji PDF

Formularz oferty wykonawcy w postępowaniu

 

Ogłoszenie

o udzieleniu zamówienia z dziedziny nauki z dnia 28.10.2014

numer ogłoszenia 2/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30d ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

1. Nazwa i adres Zamawiającego:

   MUZEUM I INSTYTUT ZOOLOGII    

   POLSKIEJ AKADEMII NAUK

   ul. Wilcza 64

   00-679 Warszawa

   tel.: 22 629 32 21

   fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

 

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

 

4. Opis przedmiotu zamówienia/zakres zamówienia:

Przedmiotem zamówienia jest dostawa odczynników na potrzeby grantu badawczego Narodowego Centrum Nauki „Dlaczego płazy w miastach zanikają? Wpływ gradientu  urbanizacyjnego na wybrane parametry demograficzne populacji dwóch gatunków płazów: ropuchy zielonej (Bufo viridis) i ropuchy szarej (Bufo bufo).” (nr rej. N N304 335839) w podziale na zadania:

Zadanie 2: Fiolet krezylu (barwnik) – 1 op 10g, nr katalogowy produktu C5042-10G

Zadanie 3: Kwas mrówkowy 98 - 100%   1 litr, nr katalogowy produktu 27001-1L-R

 

5. Liczba złożonych ofert:  1

Nr oferty

Nazwa i adres wykonawcy

Oferowana cena netto/brutto

1.

Sigma-Aldrich Sp. z o.o.,

Szelągowska 30 61-626 Poznań

Tel: 061 829 01 00

Fax: 061 829 01 20

828,33/1018,85

 

  1. 6.    Propozycja wybory oferty najkorzystniejszej – oferta nr  1

 

  1. 7.    Uzasadnienie wyboru oferty najkorzystniejszej: jedyna złożona oferta

 

 

  1. 8.    Uzasadnienie odrzucenia oferty (o ile dotyczy): nie dotyczy

 

  1. 9.    Wykonawca, któremu udzielono zamówienia:

Nazwa (firma) lub imię i nazwisko: Sigma-Aldrich Sp. z o.o.

Adres Wykonawcy: ul. Szelągowska 30 61-626 Poznań

Data udzielenia zamówienia: 06.11.2014r.

 

10.Informacja o nieudzieleniu tego zamówienia:

Czy zamówienia udzielono TAK [X]   NIE  [   ]

 

 

 

Warszawa, dnia 06.11.2014 r.

      (miejscowość)

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzieleniu

                                                                                                                                             zamówienia z dziedziny nauki

 

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 04.11.2014 r.

numer ogłoszenia 3/2014

 

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

 

  1. 1.    Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII       

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

 

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa odczynników w podziale na zadania:

Zadanie  1: 1 op. Taq PCR Master Mix (2x) EURx E2520-03

Zadanie  2: 2 op. QIAGEN Multiplex PCR Kit 100 206143

Zadanie  3: 3 op. CEQ Separation Gel LPA Beckman Coulter 608010

Zadanie  4: 3 op. CEQ Separation Buffer, 4/pk Beckman Coulter 608012

Zadanie  5: 4 op. CEQ DNA Size Standard 400 Beckman Coulter 608098

Zadanie  6: 3 op. Sample Loading Solution Beckman Coulter 608082

Zadanie  7: 1 op. GeneRuler™ 100bp DNA Ladder, 1000 applic Thermo Scientific SM0242

Zadanie  8: 53 szt. Oligonukleotydów – skala syntezy: 0,025 lub 0,02 µmol; metoda oczyszczania:  odsalanie; zawieszone w wodzie w stężeniu 100 µM

Nazwa

Sekwencja 5'-3'

Str60INRA_F

CGGTGTGCTTGTCAGGTTTC

Str73INRA_F

CCTGGAGATCCTCCAGCAGGA

SsoSL417_F

TTGTTCAGTGTATATGTGTCCCAT

Ssa410Uos_F

GGAAAATAATCAATGCTGCTGGTT

Ssa408Uos_F

AATGGATTACGGGTACGTTAGACA

SsaD190_F

GGCATTGGAGGTAAGGACAC

SSsp2213_F

ATGTGGAGGTCAACTAACCAGCGTG

OMM1064_F

AGAATGCTACTGGTGGCTGTATTGTGA

SsaD71_F

AACGTGAAACATAAATCGATGG

Str60INRA_R

GTCAAGTCAGCAAGCCTCAC

Str73INRA_R

CTATTCTGCTTGTAACTAGACCTA

SsoSL417_R

GATCTTCACTGCCACCTTATGACC

Ssa410Uos_R

CTACAATCTGGACTATCTTCTTCA

Ssa408Uos_R

CTCTTGTGCAGGTTCTTCATCTGT

SsaD190_R

CCAGACCACTGAACTTCTCATC

SSsp2213_R

CATCAATCACAGAGTGAGGCACTCG

OMM1064_R

TCTGAAAGACAGGTGGATGGTTCC

SsaD71_R

TTAAGAATGGGTTGCCTATGAG

BM757_R

TTGAGCCACCAAGGAACC

BM4513_R

TCAGCAATTGAACCAACTTCA

CSSM43_R

GTTACAAATTTAAGAGACAGAGTT

CSSM66_R

ACACAAATCCTTTCTGCCAGCTGA

IDVGA37_R

CCTCTCTTTCTCTATGCTCACA

ILSTS6_R

ACACGGAAGCGATCTAAACG

INRA107_R

GGAGAGCCGAGGGCTTCAGC

INRA40_R

CTCTGCCCTGGGGATGATTG

INRA121_R

CTTCACTATTCCCCACAAAGC

RM12_R

ACTGGGAACCAAGGACTGTCA

RM188_R

GCACTATTGGGCTGGTGATT

TGLA53_R

ATCTTCACATGATATTACAGCAGA

TGLA10_R

CTAAATTTATCCCACTGTGGCTCTT

TGLA127_R

ACACTATTGCAAAAGGACCTCCAATT

Nyc3H

TAGAATHTCAGCTTTGGGTGYTSAKG

Nyc4H

ACDGARAADCCVCCTCARATTCA

Nyc824L

TRTTYGCCTAYGCYATCCT

Nyc840L

YCTWCGATCAATYCCCAAYAA

Nyc1H

CCCTTYKYYGGTTTACAAGAC

Nyc371L

TAGCMACYGCYTTYATAGG

Nyc953H

CGGAAKRTYATGCTTCGTTG

HippH1

CATCARGAKATRCTTGA

HippL1

CCGTTGTATTTCAACTATAAGAACA

Nyc5H

CAGAGAAACCACCTCAGATTCAT

Nyc2L

ATCTGTCGAGACGTAAACTACGG

glo7L

CAYCGTTGTATTTCAACTRTAAGAAC

glo6H

CGGTGTAATGRATATACTACATRG

glo1L

GTCCTGCCATGWGGACAAATATC

glo5L

CCAGAYCTYCTAGGAGAYCCAG

L14724

CGAAGCTTGATATGAAAAACCATCGTTG

H15260

GCGAAGAATCGWGTKAGKGTRGCTTT

L15171

CATGAGGACAAATATCATTCTGAGG

H15915

AACTGCAGTCATCTCCGGTTTACAAGAC

RAG2F220

GATTCCTGCTAYCTYCCTCCTCT

RAG2R995

CCCATGTTGCTTCCAAACCATA

 

   Zadanie  9: 1 op. Anty-inhibitor PCR RP-50 (100 reakcji) DNA-GDAŃSK

Zadanie 10: 14 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

 

Nazwa

Sekwencja 5'-3'

BM757_F

[D2]-TGGAAACAATGTAAACCTGGG

BM4513_F

[D3]-GCGCAAGTTTCCTCATGC

CSSM43_F

[D3]-AAAACTCTGGGAACTTGAAAACTA

CSSM66_F

[D3]-AATTTAATGCACTGAGGAGCTTGG

IDVGA37_F

[D4]-TAACAGGACAAGTCTTCAGGTG

ILSTS6_F

[D4]-TGTCTGTATTTCTGCTGTGG

INRA107_F

[D3]-TCCCAGATACAGATGCAACAG

INRA40_F

[D4]-TCAGTCTGGAGGAGAGAAAAC

INRA121_F

[D3]-GGAAACCCATTGGAGGATTTG

RM12_F

[D2]-CTGAGCTCAGGGGTTTTTGCT

RM188_F

[D2]-GGGTTCACAAAGAGCTGGAC

TGLA53_F

[D2]-GCTTTCAGAAATAGTTTGCATTCA

TGLA10_F

[D2]-CAATCTGCAGTAGCATACATCCTTG

TGLA127_F

[D4]-CAATTGTGTGGTAGTTTGGACATTC

 

   Zadanie  11: 1 op. NucleoSpin®Soil 50 izolacji MACHEREY-NAGEL740 780.50

 

 

Uzasadnienie zastosowania art. 4 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych.

Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

 

 

 

 

 

 

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Oryginał do pobrania: TUTAJ

 

Podkategorie

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi