foto Piotr Ślipiński

Ogłoszenie

o udzielanym zamówieniu z dziedziny nauki z dnia 30.06.2015 r.

numer ogłoszenia 11/2015

 

Podstawa prawna ogłoszenia: art. 4 pkt 8a ustawy z dnia 29 stycznia 2004 r. Prawo zamówień publicznych (Dz.U. z 2013r., poz. 907 z późn. zm.) w związku z art. 30a ustawy z dnia 30 kwietnia 2010 r. o zasadach finansowania nauki (Dz. U. Nr 96, poz. 615, z późn. zm.).

 

  1. Nazwa i adres Zamawiającego:

MUZEUM I INSTYTUT ZOOLOGII  

POLSKIEJ AKADEMII NAUK

ul. Wilcza 64

00-679 Warszawa

tel.: 22 629 32 21

fax.: (0 22) 629 63 02

2. Strona internetowa Zamawiającego (Biuletyn Informacji Publicznej):

http://bip.miiz.waw.pl/

3. Rodzaj zamówienia: dostawy [X] usługi [  ]

4. Opis przedmiotu zamówienia/zakres zamówienia:

     Przedmiotem zamówienia jest dostawa:

Zadanie 1: Separation Gel - LPAI 10 mL, nr kat. 608010, 14 op.

Zadanie 2: GeXP DNA Size Standard Kit – 400, nr kat. 608098, 8 op.

Zadanie 3: CEQ Separation Buffer, nr kat. 608012, 6 op.

Zadanie 4: Sample Loading Solution 6.0 mL, nr kat. 608082, 7 op.

Zadanie 5: CEQ Capillary Array, nr kat. 608087, 1 op.

Zadanie 6: QIAGEN Multiplex PCR Kit (100), nr kat. 206143, 2 op.

Zadanie 7: 8 szt. Oligonukleotydów WellRED, wydajność syntezy: 2 OD, oczyszczanie: RP1

Nazwa

Sekwencja 5'-3'

Msca43_F

[D2]- CGACCGCGCACTTAATCGCG

Msca64_F

[D3]- GTTATCGTCACTATTACTGTCGC

Msca47_F

[D4]- GAACTGGATGCAAAGAGGCGC

Msca78_F

[D3]- CGGGTTAACGTGTTACTGGAG

Myrt4_F

[D3]- CGTGCATGCGAGCATTCCGT

Msca1_F

[D3]- ACCAGGAAATGAGCCAACAG

MP84_F

[D2]- GCAGTTTAGGCGAGGCTCGAC

MP67_F

[D4]-GTTCTCTGAGCTTCTCTCCTAC

 

Uzasadnienie zastosowania art. 4 ust 8a PZP

Przedmiotem zamówienia jest dostawa służąca wyłącznie do celów prac badawczych, eksperymentalnych, naukowych lub rozwojowych. Nie służą one prowadzeniu przez zamawiającego produkcji seryjnej, mającej na celu osiągnięcie rentowności rynkowej lub pokryciu kosztów badań lub rozwoju.

 

..........................................................

                                  (podpis osoby upoważnionej)

Zatwierdzam treść ogłoszenia o udzielanym

                                                                                                                                             zamówieniu z dziedziny nauki

Szukaj

Oferty Pracy

Ogłoszenia

Przetargi

 

Instytucje

 

fauna europaea

fundacja na rzecz nauki polskiej


  

 

vibrant